\
| Variant ID: vg1218054771 (JBrowse) | Variation Type: INDEL |
| Chromosome: chr12 | Position: 18054771 |
| Reference Allele: GGACTTAACTTTA | Alternative Allele: AGACTTAACTTTA,TGACTTAACTTTA,G |
| Primary Allele: GGACTTAACTTTA | Secondary Allele: AGACTTAACTTTA |
Inferred Ancestral Allele: Not determined.
CGAAGAAAAAAAGTTATGTTGCACTTTGATTTCGGATTGAGTCATTAGTTTGAAAAACGCTTGGAGTTTTCAAAGGGTATAAGGTGGTGCTTGGATCCAG[GGACTTAACTTTA/AGACTTAACTTTA,TGACTTAACTTTA,G]
GTCCCTATATTTAGACACTAATTTAGAGTATTAGATATAGACTACTTACAAAACTAATTACATAAATGAAAACTAATTCGCGAGACAAATATTTTAAGCC
GGCTTAAAATATTTGTCTCGCGAATTAGTTTTCATTTATGTAATTAGTTTTGTAAGTAGTCTATATCTAATACTCTAAATTAGTGTCTAAATATAGGGAC[TAAAGTTAAGTCC/TAAAGTTAAGTCT,TAAAGTTAAGTCA,C]
CTGGATCCAAGCACCACCTTATACCCTTTGAAAACTCCAAGCGTTTTTCAAACTAATGACTCAATCCGAAATCAAAGTGCAACATAACTTTTTTTCTTCG
| Populations | Population Size | Frequency of GGACTTAACTTTA(primary allele) | Frequency of AGACTTAACTTTA(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 80.30% | 18.50% | 0.11% | 0.47% | TGACTTAACTTTA: 0.59%; G: 0.04% |
| All Indica | 2759 | 96.30% | 2.00% | 0.04% | 0.80% | TGACTTAACTTTA: 0.83%; G: 0.07% |
| All Japonica | 1512 | 50.30% | 49.20% | 0.13% | 0.00% | TGACTTAACTTTA: 0.33% |
| Aus | 269 | 90.30% | 9.70% | 0.00% | 0.00% | NA |
| Indica I | 595 | 98.30% | 1.70% | 0.00% | 0.00% | NA |
| Indica II | 465 | 98.90% | 0.60% | 0.00% | 0.43% | NA |
| Indica III | 913 | 95.80% | 0.40% | 0.11% | 2.08% | TGACTTAACTTTA: 1.31%; G: 0.22% |
| Indica Intermediate | 786 | 93.80% | 4.70% | 0.00% | 0.13% | TGACTTAACTTTA: 1.40% |
| Temperate Japonica | 767 | 65.60% | 34.30% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 26.80% | 72.80% | 0.20% | 0.00% | TGACTTAACTTTA: 0.20% |
| Japonica Intermediate | 241 | 51.00% | 47.30% | 0.00% | 0.00% | TGACTTAACTTTA: 1.66% |
| VI/Aromatic | 96 | 68.80% | 30.20% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 77.80% | 21.10% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1218054771 | GGACTTAACTTTA -> TGACTTAACTTTA | LOC_Os12g30120-LOC_Os12g30130 | intergenic_region ; MODIFIER | silent_mutation | Average:47.411; most accessible tissue: Callus, score: 75.511 | N | N | N | N |
| vg1218054771 | GGACTTAACTTTA -> DEL | N | N | silent_mutation | Average:47.411; most accessible tissue: Callus, score: 75.511 | N | N | N | N |
| vg1218054771 | GGACTTAACTTTA -> G | LOC_Os12g30120-LOC_Os12g30130 | intergenic_region ; MODIFIER | silent_mutation | Average:47.411; most accessible tissue: Callus, score: 75.511 | N | N | N | N |
| vg1218054771 | GGACTTAACTTTA -> AGACTTAACTTTA | LOC_Os12g30120-LOC_Os12g30130 | intergenic_region ; MODIFIER | silent_mutation | Average:47.411; most accessible tissue: Callus, score: 75.511 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1218054771 | NA | 7.89E-07 | mr1010 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218054771 | NA | 3.18E-06 | mr1041 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218054771 | 4.52E-06 | NA | mr1046 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218054771 | 8.17E-06 | NA | mr1048 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218054771 | 3.09E-06 | NA | mr1060 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218054771 | NA | 2.14E-10 | mr1070 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218054771 | NA | 1.92E-13 | mr1084 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218054771 | NA | 1.16E-09 | mr1097 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218054771 | NA | 1.19E-08 | mr1163 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218054771 | NA | 2.85E-06 | mr1171 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218054771 | NA | 4.35E-06 | mr1171 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218054771 | NA | 7.55E-06 | mr1192 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218054771 | NA | 1.13E-15 | mr1205 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218054771 | 1.10E-06 | 4.18E-09 | mr1206 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218054771 | NA | 9.30E-06 | mr1215 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218054771 | NA | 4.51E-07 | mr1245 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218054771 | NA | 4.98E-07 | mr1278 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218054771 | NA | 8.73E-06 | mr1280 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218054771 | NA | 7.60E-06 | mr1284 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218054771 | NA | 2.07E-06 | mr1293 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218054771 | NA | 3.76E-10 | mr1302 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218054771 | NA | 1.10E-08 | mr1315 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218054771 | NA | 9.06E-06 | mr1319 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218054771 | NA | 6.90E-07 | mr1338 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218054771 | 7.06E-06 | 7.08E-06 | mr1356 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218054771 | 6.34E-06 | NA | mr1359 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218054771 | NA | 8.83E-06 | mr1359 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218054771 | NA | 3.42E-07 | mr1392 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218054771 | NA | 1.45E-07 | mr1405 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218054771 | 8.06E-06 | 1.82E-09 | mr1418 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218054771 | NA | 2.83E-09 | mr1420 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218054771 | NA | 4.80E-06 | mr1450 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218054771 | NA | 8.74E-07 | mr1461 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218054771 | 5.35E-06 | 2.35E-11 | mr1488 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218054771 | NA | 1.95E-07 | mr1492 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218054771 | NA | 4.04E-06 | mr1492 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218054771 | NA | 2.99E-11 | mr1506 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218054771 | 5.66E-06 | 2.36E-08 | mr1507 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218054771 | NA | 4.37E-06 | mr1511 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218054771 | NA | 2.57E-14 | mr1521 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218054771 | NA | 5.35E-07 | mr1548 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218054771 | NA | 7.08E-09 | mr1604 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218054771 | NA | 2.17E-08 | mr1617 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218054771 | NA | 1.73E-11 | mr1683 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218054771 | NA | 4.95E-06 | mr1729 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218054771 | NA | 2.59E-08 | mr1764 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218054771 | NA | 8.32E-06 | mr1773 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218054771 | NA | 7.48E-14 | mr1775 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218054771 | 1.17E-07 | 6.30E-13 | mr1779 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218054771 | 2.82E-06 | 2.82E-06 | mr1779 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218054771 | NA | 7.67E-06 | mr1786 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218054771 | NA | 2.00E-10 | mr1797 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218054771 | NA | 2.00E-10 | mr1801 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218054771 | NA | 5.56E-07 | mr1802 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218054771 | NA | 2.44E-06 | mr1809 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218054771 | 7.36E-06 | 1.27E-10 | mr1810 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218054771 | NA | 1.29E-06 | mr1811 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218054771 | NA | 4.31E-07 | mr1812 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218054771 | NA | 5.20E-06 | mr1816 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218054771 | 6.70E-06 | 2.79E-10 | mr1824 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218054771 | NA | 1.13E-06 | mr1832 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218054771 | NA | 7.37E-07 | mr1881 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218054771 | NA | 5.32E-08 | mr1886 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218054771 | 8.08E-06 | NA | mr1920 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218054771 | NA | 1.41E-08 | mr1992 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |