\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1218050442:

Variant ID: vg1218050442 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 18050442
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.57, G: 0.43, others allele: 0.00, population size: 90. )

Flanking Sequence (100 bp) in Reference Genome:


CAAAATCGTAGGTCCGAATTCGGACCAATCAGAAACTGGCAGAAAAGCCAGCATTAGATATTAGATATATTGATTGATTGATTGAGATTTACCATCCTTG[A/G]
AAATGTTAGTGACCTTTATGACCCCACCTGCCACATGTTATTGGCATATAATGATAATCCTTATAGTTTTAGATCAAAATGAAGGGACATAATCAAATTT

Reverse complement sequence

AAATTTGATTATGTCCCTTCATTTTGATCTAAAACTATAAGGATTATCATTATATGCCAATAACATGTGGCAGGTGGGGTCATAAAGGTCACTAACATTT[T/C]
CAAGGATGGTAAATCTCAATCAATCAATCAATATATCTAATATCTAATGCTGGCTTTTCTGCCAGTTTCTGATTGGTCCGAATTCGGACCTACGATTTTG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 53.20% 46.60% 0.30% 0.00% NA
All Indica  2759 70.90% 28.70% 0.36% 0.00% NA
All Japonica  1512 14.20% 85.80% 0.00% 0.00% NA
Aus  269 89.60% 8.90% 1.49% 0.00% NA
Indica I  595 46.90% 52.40% 0.67% 0.00% NA
Indica II  465 83.20% 16.80% 0.00% 0.00% NA
Indica III  913 83.90% 16.10% 0.00% 0.00% NA
Indica Intermediate  786 66.70% 32.60% 0.76% 0.00% NA
Temperate Japonica  767 2.00% 98.00% 0.00% 0.00% NA
Tropical Japonica  504 24.60% 75.40% 0.00% 0.00% NA
Japonica Intermediate  241 31.10% 68.90% 0.00% 0.00% NA
VI/Aromatic  96 66.70% 33.30% 0.00% 0.00% NA
Intermediate  90 41.10% 58.90% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1218050442 A -> G LOC_Os12g30120.1 upstream_gene_variant ; 2582.0bp to feature; MODIFIER silent_mutation Average:58.252; most accessible tissue: Zhenshan97 panicle, score: 74.671 N N N N
vg1218050442 A -> G LOC_Os12g30120-LOC_Os12g30130 intergenic_region ; MODIFIER silent_mutation Average:58.252; most accessible tissue: Zhenshan97 panicle, score: 74.671 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1218050442 NA 3.77E-11 mr1232 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218050442 NA 1.25E-06 mr1291 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218050442 NA 3.32E-06 mr1443 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218050442 NA 2.41E-10 mr1471 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218050442 8.70E-06 3.17E-06 mr1471 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218050442 2.16E-06 1.97E-06 mr1645 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218050442 4.05E-06 2.30E-06 mr1647 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218050442 NA 1.53E-08 mr1659 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218050442 NA 9.88E-11 mr1722 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218050442 7.82E-07 7.82E-07 mr1722 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218050442 NA 8.08E-07 mr1815 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218050442 NA 3.45E-06 mr1815 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251