\
| Variant ID: vg1218047368 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 18047368 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, T: 0.00, others allele: 0.00, population size: 304. )
TTAGTGTGTACCTTGCCCCATTCGACCATACGACTTAATTCAGCTGCAGAAGAACGAAAAGTCCCATCACCATTATCATGCACCACCCACTTCCATCTAC[C/T]
AGGTATGAACCTCTCCAACTCAGAAATAATAGAACTTACAGACATCTGTCCTTTAGTGACCTTAACCATAGCCGCTTTAGGCTCATGCTTAACCCTCATT
AATGAGGGTTAAGCATGAGCCTAAAGCGGCTATGGTTAAGGTCACTAAAGGACAGATGTCTGTAAGTTCTATTATTTCTGAGTTGGAGAGGTTCATACCT[G/A]
GTAGATGGAAGTGGGTGGTGCATGATAATGGTGATGGGACTTTTCGTTCTTCTGCAGCTGAATTAAGTCGTATGGTCGAATGGGGCAAGGTACACACTAA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 93.00% | 6.60% | 0.00% | 0.42% | NA |
| All Indica | 2759 | 88.20% | 11.10% | 0.00% | 0.72% | NA |
| All Japonica | 1512 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 92.80% | 7.20% | 0.00% | 0.00% | NA |
| Indica II | 465 | 77.60% | 21.90% | 0.00% | 0.43% | NA |
| Indica III | 913 | 90.70% | 7.40% | 0.00% | 1.86% | NA |
| Indica Intermediate | 786 | 88.00% | 11.80% | 0.00% | 0.13% | NA |
| Temperate Japonica | 767 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 95.60% | 4.40% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1218047368 | C -> DEL | LOC_Os12g30120.1 | N | frameshift_variant | Average:36.792; most accessible tissue: Minghui63 young leaf, score: 65.161 | N | N | N | N |
| vg1218047368 | C -> T | LOC_Os12g30120.1 | missense_variant ; p.Gly165Ser; MODERATE | nonsynonymous_codon ; G165S | Average:36.792; most accessible tissue: Minghui63 young leaf, score: 65.161 | unknown | unknown | DELETERIOUS | 0.02 |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1218047368 | NA | 5.39E-06 | mr1006 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218047368 | NA | 4.78E-06 | mr1030 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218047368 | NA | 1.05E-06 | mr1268 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218047368 | NA | 4.21E-06 | mr1268 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218047368 | 9.38E-06 | 9.69E-07 | mr1321 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218047368 | NA | 8.92E-07 | mr1371 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218047368 | NA | 1.14E-06 | mr1371 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218047368 | 8.75E-06 | NA | mr1519 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218047368 | 2.43E-06 | 1.82E-06 | mr1545 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218047368 | 1.41E-06 | 1.41E-06 | mr1545 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218047368 | NA | 1.67E-06 | mr1621 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218047368 | 8.35E-06 | 2.81E-06 | mr1621 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218047368 | NA | 8.05E-06 | mr1749 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218047368 | NA | 9.27E-07 | mr1761 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218047368 | NA | 1.23E-08 | mr1769 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218047368 | NA | 1.11E-07 | mr1951 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |