\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1218024972:

Variant ID: vg1218024972 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 18024972
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 72. )

Flanking Sequence (100 bp) in Reference Genome:


ATGTCACACCCCAACATCCCCCATTCATATACATTCATTCATATACACAACCATCAATATATTTAACACAACCACATTCACATAACATCCATTTTGATCA[T/C]
ATATTTCATATCCATTCACATATTTCACATATTATATTAGCAAAACCGAGTTAATTGGATCAAATATTATATTTAGCAAGTATTATTATGAAGAGGAAGC

Reverse complement sequence

GCTTCCTCTTCATAATAATACTTGCTAAATATAATATTTGATCCAATTAACTCGGTTTTGCTAATATAATATGTGAAATATGTGAATGGATATGAAATAT[A/G]
TGATCAAAATGGATGTTATGTGAATGTGGTTGTGTTAAATATATTGATGGTTGTGTATATGAATGAATGTATATGAATGGGGGATGTTGGGGTGTGACAT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 37.90% 3.60% 1.18% 57.30% NA
All Indica  2759 32.50% 2.00% 1.09% 64.41% NA
All Japonica  1512 38.40% 7.30% 1.12% 53.11% NA
Aus  269 88.10% 0.00% 1.86% 10.04% NA
Indica I  595 30.10% 0.00% 1.34% 68.57% NA
Indica II  465 18.70% 9.70% 1.08% 70.54% NA
Indica III  913 41.70% 0.00% 0.66% 57.61% NA
Indica Intermediate  786 31.80% 1.30% 1.40% 65.52% NA
Temperate Japonica  767 66.20% 0.10% 0.39% 33.25% NA
Tropical Japonica  504 3.00% 19.80% 2.78% 74.40% NA
Japonica Intermediate  241 24.10% 4.10% 0.00% 71.78% NA
VI/Aromatic  96 31.20% 3.10% 2.08% 63.54% NA
Intermediate  90 52.20% 1.10% 2.22% 44.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1218024972 T -> C LOC_Os12g30100.1 upstream_gene_variant ; 4964.0bp to feature; MODIFIER silent_mutation Average:18.017; most accessible tissue: Minghui63 panicle, score: 42.799 N N N N
vg1218024972 T -> C LOC_Os12g30080-LOC_Os12g30100 intergenic_region ; MODIFIER silent_mutation Average:18.017; most accessible tissue: Minghui63 panicle, score: 42.799 N N N N
vg1218024972 T -> DEL N N silent_mutation Average:18.017; most accessible tissue: Minghui63 panicle, score: 42.799 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1218024972 NA 1.88E-06 mr1082 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218024972 NA 1.55E-07 mr1093 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218024972 NA 3.42E-08 mr1301 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218024972 NA 1.90E-06 mr1352 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218024972 NA 2.27E-06 mr1364 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218024972 NA 3.63E-09 mr1410 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218024972 8.27E-06 NA mr1428 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218024972 NA 1.85E-06 mr1443 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218024972 NA 3.03E-09 mr1546 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218024972 NA 8.94E-06 mr1780 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218024972 4.15E-06 2.56E-07 mr1792 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218024972 4.42E-06 3.86E-07 mr1792 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218024972 NA 2.29E-07 mr1089_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218024972 NA 2.67E-09 mr1093_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218024972 NA 2.21E-08 mr1235_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218024972 NA 4.70E-08 mr1599_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218024972 NA 4.06E-06 mr1792_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251