\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1218024396:

Variant ID: vg1218024396 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 18024396
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TCACAGGTTAGAAGTCACAGCTGTGAAGAGTTATCTCAATCGGGCAAACGGCCGTCACGGATGAATCTATCTTAATCGTGCCCTAATTAAAGCCCGTCAC[C/T]
GATAGCTTTGACCCAGACGACTAATCAAACTATAGCCCGTCACAGATGACCTATCTCAATCGGGCCACAACTAGCGTTCGTCACAGATGACCCTTATCTG

Reverse complement sequence

CAGATAAGGGTCATCTGTGACGAACGCTAGTTGTGGCCCGATTGAGATAGGTCATCTGTGACGGGCTATAGTTTGATTAGTCGTCTGGGTCAAAGCTATC[G/A]
GTGACGGGCTTTAATTAGGGCACGATTAAGATAGATTCATCCGTGACGGCCGTTTGCCCGATTGAGATAACTCTTCACAGCTGTGACTTCTAACCTGTGA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 30.00% 11.40% 0.30% 58.29% NA
All Indica  2759 23.30% 11.20% 0.40% 65.06% NA
All Japonica  1512 45.20% 0.30% 0.13% 54.37% NA
Aus  269 19.30% 68.00% 0.37% 12.27% NA
Indica I  595 10.40% 19.80% 0.50% 69.24% NA
Indica II  465 27.10% 0.90% 0.22% 71.83% NA
Indica III  913 27.10% 14.90% 0.22% 57.83% NA
Indica Intermediate  786 26.50% 6.60% 0.64% 66.28% NA
Temperate Japonica  767 66.10% 0.30% 0.00% 33.64% NA
Tropical Japonica  504 22.40% 0.20% 0.20% 77.18% NA
Japonica Intermediate  241 26.10% 0.80% 0.41% 72.61% NA
VI/Aromatic  96 7.30% 26.00% 0.00% 66.67% NA
Intermediate  90 36.70% 17.80% 0.00% 45.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1218024396 C -> DEL N N silent_mutation Average:35.926; most accessible tissue: Minghui63 panicle, score: 64.459 N N N N
vg1218024396 C -> T LOC_Os12g30080-LOC_Os12g30100 intergenic_region ; MODIFIER silent_mutation Average:35.926; most accessible tissue: Minghui63 panicle, score: 64.459 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1218024396 NA 1.75E-06 mr1004 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218024396 NA 2.61E-12 mr1006 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218024396 6.17E-06 1.13E-10 mr1007 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218024396 8.55E-06 2.03E-12 mr1052 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218024396 NA 4.11E-07 mr1651 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218024396 NA 9.82E-06 mr1904 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218024396 NA 9.85E-09 mr1942 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218024396 NA 5.46E-06 mr1006_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251