\
| Variant ID: vg1218024396 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 18024396 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
TCACAGGTTAGAAGTCACAGCTGTGAAGAGTTATCTCAATCGGGCAAACGGCCGTCACGGATGAATCTATCTTAATCGTGCCCTAATTAAAGCCCGTCAC[C/T]
GATAGCTTTGACCCAGACGACTAATCAAACTATAGCCCGTCACAGATGACCTATCTCAATCGGGCCACAACTAGCGTTCGTCACAGATGACCCTTATCTG
CAGATAAGGGTCATCTGTGACGAACGCTAGTTGTGGCCCGATTGAGATAGGTCATCTGTGACGGGCTATAGTTTGATTAGTCGTCTGGGTCAAAGCTATC[G/A]
GTGACGGGCTTTAATTAGGGCACGATTAAGATAGATTCATCCGTGACGGCCGTTTGCCCGATTGAGATAACTCTTCACAGCTGTGACTTCTAACCTGTGA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 30.00% | 11.40% | 0.30% | 58.29% | NA |
| All Indica | 2759 | 23.30% | 11.20% | 0.40% | 65.06% | NA |
| All Japonica | 1512 | 45.20% | 0.30% | 0.13% | 54.37% | NA |
| Aus | 269 | 19.30% | 68.00% | 0.37% | 12.27% | NA |
| Indica I | 595 | 10.40% | 19.80% | 0.50% | 69.24% | NA |
| Indica II | 465 | 27.10% | 0.90% | 0.22% | 71.83% | NA |
| Indica III | 913 | 27.10% | 14.90% | 0.22% | 57.83% | NA |
| Indica Intermediate | 786 | 26.50% | 6.60% | 0.64% | 66.28% | NA |
| Temperate Japonica | 767 | 66.10% | 0.30% | 0.00% | 33.64% | NA |
| Tropical Japonica | 504 | 22.40% | 0.20% | 0.20% | 77.18% | NA |
| Japonica Intermediate | 241 | 26.10% | 0.80% | 0.41% | 72.61% | NA |
| VI/Aromatic | 96 | 7.30% | 26.00% | 0.00% | 66.67% | NA |
| Intermediate | 90 | 36.70% | 17.80% | 0.00% | 45.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1218024396 | C -> DEL | N | N | silent_mutation | Average:35.926; most accessible tissue: Minghui63 panicle, score: 64.459 | N | N | N | N |
| vg1218024396 | C -> T | LOC_Os12g30080-LOC_Os12g30100 | intergenic_region ; MODIFIER | silent_mutation | Average:35.926; most accessible tissue: Minghui63 panicle, score: 64.459 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1218024396 | NA | 1.75E-06 | mr1004 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218024396 | NA | 2.61E-12 | mr1006 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218024396 | 6.17E-06 | 1.13E-10 | mr1007 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218024396 | 8.55E-06 | 2.03E-12 | mr1052 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218024396 | NA | 4.11E-07 | mr1651 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218024396 | NA | 9.82E-06 | mr1904 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218024396 | NA | 9.85E-09 | mr1942 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218024396 | NA | 5.46E-06 | mr1006_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |