\
| Variant ID: vg1218022863 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 18022863 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.01, others allele: 0.00, population size: 313. )
ATCAAATTGTTATCTGCATCTATATATAGTTGGTGGAGACGCCAGAATTATCTAAAGAAAATCAGAATGCCTTGAAAAAAAAAGAGAGGTACACGAGGGT[G/A]
GGAATGAGATGTATTCAGGAAACAGGTGACAAGAACAAGATTCATTGTGGATCAAGTAGGATCGGAAGGTCAACATGACCTGATTGATTGCCAACATATG
CATATGTTGGCAATCAATCAGGTCATGTTGACCTTCCGATCCTACTTGATCCACAATGAATCTTGTTCTTGTCACCTGTTTCCTGAATACATCTCATTCC[C/T]
ACCCTCGTGTACCTCTCTTTTTTTTTCAAGGCATTCTGATTTTCTTTAGATAATTCTGGCGTCTCCACCAACTATATATAGATGCAGATAACAATTTGAT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 81.90% | 18.00% | 0.08% | 0.00% | NA |
| All Indica | 2759 | 71.90% | 28.00% | 0.14% | 0.00% | NA |
| All Japonica | 1512 | 95.20% | 4.80% | 0.00% | 0.00% | NA |
| Aus | 269 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 41.00% | 58.80% | 0.17% | 0.00% | NA |
| Indica II | 465 | 85.80% | 14.00% | 0.22% | 0.00% | NA |
| Indica III | 913 | 85.30% | 14.70% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 71.40% | 28.40% | 0.25% | 0.00% | NA |
| Temperate Japonica | 767 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 95.80% | 4.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 79.30% | 20.70% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 91.10% | 8.90% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1218022863 | G -> A | LOC_Os12g30080-LOC_Os12g30100 | intergenic_region ; MODIFIER | silent_mutation | Average:60.599; most accessible tissue: Zhenshan97 flower, score: 86.194 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1218022863 | NA | 2.93E-06 | mr1029 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218022863 | NA | 4.20E-06 | mr1189 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218022863 | 2.72E-06 | 2.94E-06 | mr1471 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218022863 | NA | 2.66E-06 | mr1502 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218022863 | NA | 7.34E-06 | mr1502 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218022863 | NA | 1.75E-06 | mr1625 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218022863 | 1.92E-08 | NA | mr1645 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218022863 | 2.99E-06 | 5.73E-06 | mr1645 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218022863 | 1.80E-08 | NA | mr1647 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218022863 | 2.63E-06 | 1.73E-06 | mr1647 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218022863 | 9.96E-07 | NA | mr1682 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218022863 | 4.55E-06 | NA | mr1722 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218022863 | NA | 8.90E-07 | mr1734 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218022863 | 1.32E-06 | NA | mr1815 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218022863 | 4.12E-06 | 2.62E-06 | mr1815 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |