Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1218022752:

Variant ID: vg1218022752 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 18022752
Reference Allele: C	Alternative Allele: G
Primary Allele: C	Secondary Allele: G

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, others allele: 0.00, population size: 268. )

Flanking Sequence (100 bp) in Reference Genome:

TCCACTGTCTAACTATTCGTCAGGGTCTAAAAAAGGAAGCAAAAAACATGGCTGAGGAGGTAGCAAAGATTAATTAATCGAGAAGTTGTGCAAGCATCCA[C/G]
ATATACAAATATCAAATTGTTATCTGCATCTATATATAGTTGGTGGAGACGCCAGAATTATCTAAAGAAAATCAGAATGCCTTGAAAAAAAAAGAGAGGT

Reverse complement sequence

ACCTCTCTTTTTTTTTCAAGGCATTCTGATTTTCTTTAGATAATTCTGGCGTCTCCACCAACTATATATAGATGCAGATAACAATTTGATATTTGTATAT[G/C]
TGGATGCTTGCACAACTTCTCGATTAATTAATCTTTGCTACCTCCTCAGCCATGTTTTTTGCTTCCTTTTTTAGACCCTGACGAATAGTTAGACAGTGGA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	81.90%	18.00%	0.06%	0.00%	NA
All Indica	2759	72.00%	27.90%	0.11%	0.00%	NA
All Japonica	1512	95.20%	4.80%	0.00%	0.00%	NA
Aus	269	99.60%	0.40%	0.00%	0.00%	NA
Indica I	595	41.20%	58.70%	0.17%	0.00%	NA
Indica II	465	85.80%	14.00%	0.22%	0.00%	NA
Indica III	913	85.10%	14.90%	0.00%	0.00%	NA
Indica Intermediate	786	71.90%	28.00%	0.13%	0.00%	NA
Temperate Japonica	767	99.90%	0.10%	0.00%	0.00%	NA
Tropical Japonica	504	95.80%	4.20%	0.00%	0.00%	NA
Japonica Intermediate	241	79.30%	20.70%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	91.10%	8.90%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1218022752	C -> G	LOC_Os12g30080-LOC_Os12g30100	intergenic_region ; MODIFIER	silent_mutation	Average:55.275; most accessible tissue: Zhenshan97 flower, score: 89.772	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg1218022752	C	G	-0.04	-0.01	0.0	0.01	0.01	0.02

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1218022752	NA	1.66E-06	mr1029	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218022752	NA	2.77E-06	mr1189	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218022752	2.08E-06	2.31E-06	mr1471	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218022752	NA	1.26E-06	mr1502	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218022752	NA	3.62E-06	mr1502	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218022752	NA	1.46E-06	mr1625	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218022752	4.88E-09	NA	mr1645	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218022752	1.63E-06	3.58E-06	mr1645	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218022752	9.19E-09	NA	mr1647	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218022752	2.16E-06	1.43E-06	mr1647	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218022752	3.18E-06	NA	mr1682	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218022752	4.09E-06	NA	mr1722	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218022752	NA	7.42E-07	mr1734	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218022752	1.28E-06	NA	mr1815	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218022752	4.15E-06	2.06E-06	mr1815	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218022752	NA	2.52E-06	mr1990	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251