\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1218016436:

Variant ID: vg1218016436 (JBrowse)Variation Type: INDEL
Chromosome: chr12Position: 18016436
Reference Allele: CGAAGGAAATCAGGCTAGATAlternative Allele: AGAAGGAAATCAGGCTAGAT,C
Primary Allele: CGAAGGAAATCAGGCTAGATSecondary Allele: AGAAGGAAATCAGGCTAGAT

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TGCATCAATGAAAATAGGTGCAGGTGCCGTCACAAGTACCGGCCAGGTTGTAGACGACGACATAGCTAGAGACGTACTGTAGCAGAAACGCTGGCTGGAG[CGAAGGAAATCAGGCTAGAT/AGAAGGAAATCAGGCTAGAT,C]
TTATAGCCAACTGTAACACGGATTCTAATACGTTGTGTGTATGAGATGTGGGACTATATATTAATGCTTAAAAATAACTATTATATGAATGAGCTATTAG

Reverse complement sequence

CTAATAGCTCATTCATATAATAGTTATTTTTAAGCATTAATATATAGTCCCACATCTCATACACACAACGTATTAGAATCCGTGTTACAGTTGGCTATAA[ATCTAGCCTGATTTCCTTCG/ATCTAGCCTGATTTCCTTCT,G]
CTCCAGCCAGCGTTTCTGCTACAGTACGTCTCTAGCTATGTCGTCGTCTACAACCTGGCCGGTACTTGTGACGGCACCTGCACCTATTTTCATTGATGCA

Allele Frequencies:

Populations Population SizeFrequency of CGAAGGAAATCAGGCTAGAT(primary allele) Frequency of AGAAGGAAATCAGGCTAGAT(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 62.80% 9.10% 1.29% 26.66% C: 0.19%
All Indica  2759 46.60% 15.30% 1.81% 35.96% C: 0.29%
All Japonica  1512 92.90% 0.00% 0.07% 7.01% NA
Aus  269 53.50% 0.40% 1.86% 44.24% NA
Indica I  595 9.90% 30.10% 2.52% 57.48% NA
Indica II  465 64.10% 9.70% 1.94% 24.30% NA
Indica III  913 57.30% 8.00% 1.10% 32.75% C: 0.88%
Indica Intermediate  786 51.70% 16.00% 2.04% 30.28% NA
Temperate Japonica  767 98.80% 0.00% 0.13% 1.04% NA
Tropical Japonica  504 95.20% 0.00% 0.00% 4.76% NA
Japonica Intermediate  241 69.30% 0.00% 0.00% 30.71% NA
VI/Aromatic  96 65.60% 0.00% 3.12% 30.21% C: 1.04%
Intermediate  90 77.80% 4.40% 2.22% 15.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1218016436 CGAAGGAAATCAGGCTAGAT -> C LOC_Os12g30080.1 upstream_gene_variant ; 670.0bp to feature; MODIFIER silent_mutation Average:48.337; most accessible tissue: Minghui63 root, score: 94.385 N N N N
vg1218016436 CGAAGGAAATCAGGCTAGAT -> C LOC_Os12g30080-LOC_Os12g30100 intergenic_region ; MODIFIER silent_mutation Average:48.337; most accessible tissue: Minghui63 root, score: 94.385 N N N N
vg1218016436 CGAAGGAAATCAGGCTAGAT -> DEL N N silent_mutation Average:48.337; most accessible tissue: Minghui63 root, score: 94.385 N N N N
vg1218016436 CGAAGGAAATCAGGCTAGAT -> AGAAGGAAATCAGGCTAGAT LOC_Os12g30080.1 upstream_gene_variant ; 669.0bp to feature; MODIFIER silent_mutation Average:48.337; most accessible tissue: Minghui63 root, score: 94.385 N N N N
vg1218016436 CGAAGGAAATCAGGCTAGAT -> AGAAGGAAATCAGGCTAGAT LOC_Os12g30080-LOC_Os12g30100 intergenic_region ; MODIFIER silent_mutation Average:48.337; most accessible tissue: Minghui63 root, score: 94.385 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1218016436 CGAAG* AGAAG* 0.07 0.01 0.0 -0.02 -0.01 -0.01
vg1218016436 CGAAG* C 0.74 0.18 0.03 -0.07 0.22 0.14

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1218016436 NA 5.32E-07 mr1032 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218016436 NA 3.09E-06 mr1088 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218016436 NA 2.70E-06 mr1165 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218016436 NA 3.69E-06 mr1246 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218016436 9.04E-06 6.95E-06 mr1471 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218016436 NA 1.95E-07 mr1478 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218016436 8.72E-06 NA mr1519 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218016436 NA 1.25E-07 mr1627 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218016436 1.85E-06 NA mr1645 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218016436 NA 6.85E-06 mr1660 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218016436 NA 3.62E-07 mr1971 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218016436 NA 1.97E-07 mr1063_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218016436 NA 2.42E-06 mr1128_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218016436 NA 7.09E-07 mr1180_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218016436 NA 6.74E-08 mr1183_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218016436 NA 5.25E-06 mr1220_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218016436 NA 4.79E-06 mr1302_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218016436 NA 3.42E-07 mr1653_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218016436 NA 5.18E-06 mr1844_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218016436 NA 4.06E-06 mr1854_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218016436 NA 3.30E-06 mr1854_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251