\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1218015385:

Variant ID: vg1218015385 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 18015385
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 104. )

Flanking Sequence (100 bp) in Reference Genome:


ATAGAACGCCGACAGCCTAGGATCAATGCCAAAAGTGCTAGAGTTGTGTGCTAATTGGTCAAAATTATACCTCTTGTGCCTTTCGCTTGCCTCGATCGCA[C/T]
GGATCTTGAGCTCTTCGATCTCATTGGCAATCTCATGGCGCGCCTTCAGTTTCTTCAACTTACGGAAGAATTTCCTGAAGCCCATCTTTTCCCCATCATG

Reverse complement sequence

CATGATGGGGAAAAGATGGGCTTCAGGAAATTCTTCCGTAAGTTGAAGAAACTGAAGGCGCGCCATGAGATTGCCAATGAGATCGAAGAGCTCAAGATCC[G/A]
TGCGATCGAGGCAAGCGAAAGGCACAAGAGGTATAATTTTGACCAATTAGCACACAACTCTAGCACTTTTGGCATTGATCCTAGGCTGTCGGCGTTCTAT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 90.80% 0.40% 1.63% 7.22% NA
All Indica  2759 87.40% 0.60% 1.96% 10.04% NA
All Japonica  1512 98.50% 0.10% 0.73% 0.60% NA
Aus  269 77.00% 0.00% 3.72% 19.33% NA
Indica I  595 77.10% 1.70% 5.71% 15.46% NA
Indica II  465 94.80% 0.00% 1.08% 4.09% NA
Indica III  913 90.40% 0.10% 0.22% 9.31% NA
Indica Intermediate  786 87.40% 0.60% 1.65% 10.31% NA
Temperate Japonica  767 99.10% 0.30% 0.52% 0.13% NA
Tropical Japonica  504 99.60% 0.00% 0.00% 0.40% NA
Japonica Intermediate  241 94.60% 0.00% 2.90% 2.49% NA
VI/Aromatic  96 99.00% 0.00% 0.00% 1.04% NA
Intermediate  90 95.60% 0.00% 2.22% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1218015385 C -> DEL LOC_Os12g30080.1 N frameshift_variant Average:61.382; most accessible tissue: Zhenshan97 young leaf, score: 82.763 N N N N
vg1218015385 C -> T LOC_Os12g30080.1 missense_variant ; p.Arg128His; MODERATE nonsynonymous_codon ; R128Y Average:61.382; most accessible tissue: Zhenshan97 young leaf, score: 82.763 probably damaging 2.174 DELETERIOUS 0.02
vg1218015385 C -> T LOC_Os12g30080.1 missense_variant ; p.Arg128His; MODERATE nonsynonymous_codon ; R128H Average:61.382; most accessible tissue: Zhenshan97 young leaf, score: 82.763 benign 0.864 TOLERATED 0.07

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1218015385 NA 7.46E-08 mr1038 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218015385 8.10E-07 5.41E-10 mr1038 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218015385 NA 7.90E-09 mr1060 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218015385 NA 1.04E-06 mr1316 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218015385 NA 6.33E-08 mr1389 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218015385 NA 7.96E-09 mr1389 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218015385 NA 7.18E-06 mr1520 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218015385 NA 2.64E-07 mr1614 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218015385 NA 1.03E-06 mr1716 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218015385 NA 2.25E-07 mr1937 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218015385 NA 2.43E-07 mr1008_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218015385 NA 1.61E-06 mr1015_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251