Search for Variation information by Variation ID:
Detailed information for vg1218015385:
| Variant ID: vg1218015385 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 18015385 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 104. )
Flanking Sequence (100 bp) in Reference Genome:
ATAGAACGCCGACAGCCTAGGATCAATGCCAAAAGTGCTAGAGTTGTGTGCTAATTGGTCAAAATTATACCTCTTGTGCCTTTCGCTTGCCTCGATCGCA[C/T]
GGATCTTGAGCTCTTCGATCTCATTGGCAATCTCATGGCGCGCCTTCAGTTTCTTCAACTTACGGAAGAATTTCCTGAAGCCCATCTTTTCCCCATCATG
Reverse complement sequence
CATGATGGGGAAAAGATGGGCTTCAGGAAATTCTTCCGTAAGTTGAAGAAACTGAAGGCGCGCCATGAGATTGCCAATGAGATCGAAGAGCTCAAGATCC[G/A]
TGCGATCGAGGCAAGCGAAAGGCACAAGAGGTATAATTTTGACCAATTAGCACACAACTCTAGCACTTTTGGCATTGATCCTAGGCTGTCGGCGTTCTAT
Allele Frequencies:
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 90.80% | 0.40% | 1.63% | 7.22% | NA |
| All Indica | 2759 | 87.40% | 0.60% | 1.96% | 10.04% | NA |
| All Japonica | 1512 | 98.50% | 0.10% | 0.73% | 0.60% | NA |
| Aus | 269 | 77.00% | 0.00% | 3.72% | 19.33% | NA |
| Indica I | 595 | 77.10% | 1.70% | 5.71% | 15.46% | NA |
| Indica II | 465 | 94.80% | 0.00% | 1.08% | 4.09% | NA |
| Indica III | 913 | 90.40% | 0.10% | 0.22% | 9.31% | NA |
| Indica Intermediate | 786 | 87.40% | 0.60% | 1.65% | 10.31% | NA |
| Temperate Japonica | 767 | 99.10% | 0.30% | 0.52% | 0.13% | NA |
| Tropical Japonica | 504 | 99.60% | 0.00% | 0.00% | 0.40% | NA |
| Japonica Intermediate | 241 | 94.60% | 0.00% | 2.90% | 2.49% | NA |
| VI/Aromatic | 96 | 99.00% | 0.00% | 0.00% | 1.04% | NA |
| Intermediate | 90 | 95.60% | 0.00% | 2.22% | 2.22% | NA |
Allele Effect:
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1218015385 | C -> DEL | LOC_Os12g30080.1 | N | frameshift_variant | Average:61.382; most accessible tissue: Zhenshan97 young leaf, score: 82.763 | N | N | N | N |
| vg1218015385 | C -> T | LOC_Os12g30080.1 | missense_variant ; p.Arg128His; MODERATE | nonsynonymous_codon ; R128Y | Average:61.382; most accessible tissue: Zhenshan97 young leaf, score: 82.763 | probably damaging  |
2.174 |
DELETERIOUS | 0.02 |
| vg1218015385 | C -> T | LOC_Os12g30080.1 | missense_variant ; p.Arg128His; MODERATE | nonsynonymous_codon ; R128H | Average:61.382; most accessible tissue: Zhenshan97 young leaf, score: 82.763 | benign |
0.864 |
TOLERATED | 0.07 |
Putative Genotype-Phenotype Associations:
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1218015385 | NA | 7.46E-08 | mr1038 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218015385 | 8.10E-07 | 5.41E-10 | mr1038 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218015385 | NA | 7.90E-09 | mr1060 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218015385 | NA | 1.04E-06 | mr1316 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218015385 | NA | 6.33E-08 | mr1389 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218015385 | NA | 7.96E-09 | mr1389 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218015385 | NA | 7.18E-06 | mr1520 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218015385 | NA | 2.64E-07 | mr1614 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218015385 | NA | 1.03E-06 | mr1716 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218015385 | NA | 2.25E-07 | mr1937 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218015385 | NA | 2.43E-07 | mr1008_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218015385 | NA | 1.61E-06 | mr1015_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |