\
| Variant ID: vg1217982066 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 17982066 |
| Reference Allele: A | Alternative Allele: C |
| Primary Allele: A | Secondary Allele: C |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.67, A: 0.34, others allele: 0.00, population size: 218. )
TTTTTGAATGGACACGGAGAATATGCACTGCAGTGATGGAGAATATGTGAAATCTTCAGTGATTTCCAAACCCAATCCAGTTACATCTTCCAATCAAGAA[A/C]
ACAAAATGCATATTACAGTCTCAAATCACTGAAGCAACAAAGAATCACAAGCTCAAACTGATGCAGTAAAATCAAAATATATCCCACGCCCAATCCAATT
AATTGGATTGGGCGTGGGATATATTTTGATTTTACTGCATCAGTTTGAGCTTGTGATTCTTTGTTGCTTCAGTGATTTGAGACTGTAATATGCATTTTGT[T/G]
TTCTTGATTGGAAGATGTAACTGGATTGGGTTTGGAAATCACTGAAGATTTCACATATTCTCCATCACTGCAGTGCATATTCTCCGTGTCCATTCAAAAA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 52.00% | 47.90% | 0.08% | 0.00% | NA |
| All Indica | 2759 | 32.30% | 67.60% | 0.11% | 0.00% | NA |
| All Japonica | 1512 | 85.10% | 14.90% | 0.07% | 0.00% | NA |
| Aus | 269 | 60.20% | 39.80% | 0.00% | 0.00% | NA |
| Indica I | 595 | 60.30% | 39.70% | 0.00% | 0.00% | NA |
| Indica II | 465 | 9.00% | 91.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 25.80% | 74.20% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 32.20% | 67.40% | 0.38% | 0.00% | NA |
| Temperate Japonica | 767 | 98.80% | 1.20% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 74.80% | 25.00% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 62.70% | 37.30% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 57.30% | 42.70% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 72.20% | 27.80% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1217982066 | A -> C | LOC_Os12g30040.1 | intron_variant ; MODIFIER | silent_mutation | Average:38.97; most accessible tissue: Callus, score: 85.037 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1217982066 | NA | 3.20E-13 | mr1170 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217982066 | NA | 1.97E-07 | mr1170 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217982066 | NA | 6.93E-06 | mr1261 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217982066 | NA | 2.75E-06 | mr1443 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217982066 | NA | 1.98E-07 | mr1557 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217982066 | NA | 2.40E-06 | mr1944 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217982066 | NA | 3.85E-10 | mr1170_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217982066 | NA | 1.33E-06 | mr1170_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217982066 | 2.81E-06 | NA | mr1458_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217982066 | 9.29E-06 | 5.44E-09 | mr1458_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |