\
| Variant ID: vg1217972644 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 17972644 |
| Reference Allele: T | Alternative Allele: A |
| Primary Allele: T | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
TAGAGTGAAGCTTTAGGGCTCGGCTAGAAAACATATGAAGTATGAACAGGGTTCACAAAGCCATTACTAGCGGTTTTCGAAAAGAAAAACATTGAAAAAC[T/A]
TTTGGAAATGGATAAAATTCAGATAAATGTTATTAAAAAATTAGTTTACTTTTTTAATTTGATTGTGTTGATGCGAAAAACACACACTGGCCTGGGAGAT
ATCTCCCAGGCCAGTGTGTGTTTTTCGCATCAACACAATCAAATTAAAAAAGTAAACTAATTTTTTAATAACATTTATCTGAATTTTATCCATTTCCAAA[A/T]
GTTTTTCAATGTTTTTCTTTTCGAAAACCGCTAGTAATGGCTTTGTGAACCCTGTTCATACTTCATATGTTTTCTAGCCGAGCCCTAAAGCTTCACTCTA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 93.20% | 6.80% | 0.00% | 0.00% | NA |
| All Indica | 2759 | 88.50% | 11.50% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 75.80% | 24.20% | 0.00% | 0.00% | NA |
| Indica II | 465 | 95.10% | 4.90% | 0.00% | 0.00% | NA |
| Indica III | 913 | 92.70% | 7.30% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 89.40% | 10.60% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 96.70% | 3.30% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1217972644 | T -> A | LOC_Os12g30030.2 | upstream_gene_variant ; 4896.0bp to feature; MODIFIER | silent_mutation | Average:35.547; most accessible tissue: Zhenshan97 panicle, score: 54.901 | N | N | N | N |
| vg1217972644 | T -> A | LOC_Os12g30030.1 | upstream_gene_variant ; 4896.0bp to feature; MODIFIER | silent_mutation | Average:35.547; most accessible tissue: Zhenshan97 panicle, score: 54.901 | N | N | N | N |
| vg1217972644 | T -> A | LOC_Os12g30030-LOC_Os12g30040 | intergenic_region ; MODIFIER | silent_mutation | Average:35.547; most accessible tissue: Zhenshan97 panicle, score: 54.901 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1217972644 | 2.92E-08 | 2.50E-11 | mr1038 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217972644 | 1.10E-07 | 9.29E-12 | mr1038 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217972644 | 2.69E-07 | 2.45E-11 | mr1389 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217972644 | 2.42E-06 | 1.69E-10 | mr1389 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217972644 | NA | 8.16E-06 | mr1864 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217972644 | NA | 2.06E-08 | mr1038_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217972644 | NA | 2.61E-08 | mr1038_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217972644 | NA | 6.48E-07 | mr1389_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217972644 | NA | 3.52E-07 | mr1389_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |