\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1217972644:

Variant ID: vg1217972644 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 17972644
Reference Allele: TAlternative Allele: A
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TAGAGTGAAGCTTTAGGGCTCGGCTAGAAAACATATGAAGTATGAACAGGGTTCACAAAGCCATTACTAGCGGTTTTCGAAAAGAAAAACATTGAAAAAC[T/A]
TTTGGAAATGGATAAAATTCAGATAAATGTTATTAAAAAATTAGTTTACTTTTTTAATTTGATTGTGTTGATGCGAAAAACACACACTGGCCTGGGAGAT

Reverse complement sequence

ATCTCCCAGGCCAGTGTGTGTTTTTCGCATCAACACAATCAAATTAAAAAAGTAAACTAATTTTTTAATAACATTTATCTGAATTTTATCCATTTCCAAA[A/T]
GTTTTTCAATGTTTTTCTTTTCGAAAACCGCTAGTAATGGCTTTGTGAACCCTGTTCATACTTCATATGTTTTCTAGCCGAGCCCTAAAGCTTCACTCTA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 93.20% 6.80% 0.00% 0.00% NA
All Indica  2759 88.50% 11.50% 0.00% 0.00% NA
All Japonica  1512 99.90% 0.10% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 75.80% 24.20% 0.00% 0.00% NA
Indica II  465 95.10% 4.90% 0.00% 0.00% NA
Indica III  913 92.70% 7.30% 0.00% 0.00% NA
Indica Intermediate  786 89.40% 10.60% 0.00% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 99.80% 0.20% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 96.70% 3.30% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1217972644 T -> A LOC_Os12g30030.2 upstream_gene_variant ; 4896.0bp to feature; MODIFIER silent_mutation Average:35.547; most accessible tissue: Zhenshan97 panicle, score: 54.901 N N N N
vg1217972644 T -> A LOC_Os12g30030.1 upstream_gene_variant ; 4896.0bp to feature; MODIFIER silent_mutation Average:35.547; most accessible tissue: Zhenshan97 panicle, score: 54.901 N N N N
vg1217972644 T -> A LOC_Os12g30030-LOC_Os12g30040 intergenic_region ; MODIFIER silent_mutation Average:35.547; most accessible tissue: Zhenshan97 panicle, score: 54.901 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1217972644 2.92E-08 2.50E-11 mr1038 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217972644 1.10E-07 9.29E-12 mr1038 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217972644 2.69E-07 2.45E-11 mr1389 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217972644 2.42E-06 1.69E-10 mr1389 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217972644 NA 8.16E-06 mr1864 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217972644 NA 2.06E-08 mr1038_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217972644 NA 2.61E-08 mr1038_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217972644 NA 6.48E-07 mr1389_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217972644 NA 3.52E-07 mr1389_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251