Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1217950737:

Variant ID: vg1217950737 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 17950737
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.94, G: 0.06, others allele: 0.00, population size: 195. )

Flanking Sequence (100 bp) in Reference Genome:


TCATATGCGACACCTGCACCCTGATGCGGCAGCTTGGATGTGGCCGCAGAGGCAGAGGCTTTTGAGGAGGCGGATCCAATACAGATGATGGCACTGTCGG[A/G]
CGGATTCGGCTCGAATATGGCGGCGGTGGTGGTTGAGGCAGGTGCATCTCGTTATTTTGCAGATGGAGGTGGAGGCTACGGGTGGATGCGACGCAATCAG

Reverse complement sequence

CTGATTGCGTCGCATCCACCCGTAGCCTCCACCTCCATCTGCAAAATAACGAGATGCACCTGCCTCAACCACCACCGCCGCCATATTCGAGCCGAATCCG[T/C]
CCGACAGTGCCATCATCTGTATTGGATCCGCCTCCTCAAAAGCCTCTGCCTCTGCGGCCACATCCAAGCTGCCGCATCAGGGTGCAGGTGTCGCATATGA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 74.10% 21.20% 0.11% 4.63% NA
All Indica  2759 69.50% 26.00% 0.11% 4.46% NA
All Japonica  1512 89.00% 10.80% 0.07% 0.13% NA
Aus  269 48.30% 25.70% 0.37% 25.65% NA
Indica I  595 43.90% 54.60% 0.17% 1.34% NA
Indica II  465 83.20% 15.10% 0.22% 1.51% NA
Indica III  913 76.60% 19.50% 0.00% 3.94% NA
Indica Intermediate  786 72.50% 18.20% 0.13% 9.16% NA
Temperate Japonica  767 98.60% 1.40% 0.00% 0.00% NA
Tropical Japonica  504 76.20% 23.60% 0.20% 0.00% NA
Japonica Intermediate  241 85.50% 13.70% 0.00% 0.83% NA
VI/Aromatic  96 41.70% 39.60% 0.00% 18.75% NA
Intermediate  90 76.70% 15.60% 0.00% 7.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1217950737 A -> DEL N N silent_mutation Average:95.191; most accessible tissue: Minghui63 flower, score: 97.828 N N N N
vg1217950737 A -> G LOC_Os12g30000-LOC_Os12g30020 intergenic_region ; MODIFIER silent_mutation Average:95.191; most accessible tissue: Minghui63 flower, score: 97.828 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1217950737 A G 0.04 0.02 0.01 0.02 0.02 0.03

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1217950737 NA 4.17E-10 Heading_date Ind_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1217950737 NA 1.25E-07 mr1060 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217950737 NA 1.11E-08 mr1170 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217950737 NA 6.48E-06 mr1215 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217950737 NA 9.48E-06 mr1254 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217950737 NA 2.42E-06 mr1272 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217950737 NA 5.89E-06 mr1316 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217950737 NA 2.95E-09 mr1352 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217950737 NA 9.85E-08 mr1352 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217950737 NA 4.80E-06 mr1461 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217950737 NA 6.48E-07 mr1511 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217950737 9.98E-07 9.98E-07 mr1521 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217950737 NA 3.09E-09 mr1531 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217950737 NA 4.59E-06 mr1579 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217950737 NA 7.65E-06 mr1614 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217950737 NA 1.73E-08 mr1170_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251