\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1217948662:

Variant ID: vg1217948662 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 17948662
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ACCATAAGATTAAGGGGGTGTTTAGAAGTTAGAAACTAAATTTAGTTTCTCTCATAGACTTATGTTTTTATGAGATGAACTGAAGTTTAGCCCCACTTTA[G/A]
CCCCTCCAACCAAACACCACCTAACTACTTTCTCCTCATTCCACCCATTCAACCAATCCCTAATTATATGGATCTACCCTATACTTTATACTCAATGCAC

Reverse complement sequence

GTGCATTGAGTATAAAGTATAGGGTAGATCCATATAATTAGGGATTGGTTGAATGGGTGGAATGAGGAGAAAGTAGTTAGGTGGTGTTTGGTTGGAGGGG[C/T]
TAAAGTGGGGCTAAACTTCAGTTCATCTCATAAAAACATAAGTCTATGAGAGAAACTAAATTTAGTTTCTAACTTCTAAACACCCCCTTAATCTTATGGT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 59.00% 15.50% 3.96% 21.50% NA
All Indica  2759 49.00% 13.40% 4.49% 33.06% NA
All Japonica  1512 80.40% 16.10% 1.46% 1.98% NA
Aus  269 47.60% 26.80% 1.49% 24.16% NA
Indica I  595 10.90% 7.10% 2.18% 79.83% NA
Indica II  465 81.10% 4.10% 0.86% 13.98% NA
Indica III  913 54.90% 21.70% 8.11% 15.33% NA
Indica Intermediate  786 52.00% 14.20% 4.20% 29.52% NA
Temperate Japonica  767 92.70% 6.10% 0.13% 1.04% NA
Tropical Japonica  504 63.70% 32.90% 2.78% 0.60% NA
Japonica Intermediate  241 76.30% 12.90% 2.90% 7.88% NA
VI/Aromatic  96 44.80% 20.80% 34.38% 0.00% NA
Intermediate  90 55.60% 30.00% 4.44% 10.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1217948662 G -> DEL N N silent_mutation Average:81.145; most accessible tissue: Zhenshan97 root, score: 97.877 N N N N
vg1217948662 G -> A LOC_Os12g30000-LOC_Os12g30020 intergenic_region ; MODIFIER silent_mutation Average:81.145; most accessible tissue: Zhenshan97 root, score: 97.877 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1217948662 G A 0.05 0.0 -0.01 0.0 0.01 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1217948662 NA 1.53E-06 mr1192 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217948662 NA 1.50E-07 mr1229 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217948662 8.96E-06 8.96E-06 mr1319 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217948662 NA 9.17E-06 mr1359 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217948662 NA 1.07E-07 mr1399 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217948662 5.99E-06 5.99E-06 mr1480 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217948662 NA 5.16E-09 mr1607 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217948662 NA 4.08E-07 mr1607 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217948662 NA 1.01E-06 mr1810 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217948662 3.26E-07 3.26E-07 mr1824 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217948662 NA 1.03E-06 mr1904 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217948662 NA 3.77E-06 mr1906 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217948662 NA 5.56E-10 mr1942 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217948662 NA 3.89E-08 mr1942 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217948662 NA 2.41E-06 mr1960 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217948662 NA 1.41E-09 mr1598_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251