Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1217943070:

Variant ID: vg1217943070 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 17943070
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.88, C: 0.12, others allele: 0.00, population size: 227. )

Flanking Sequence (100 bp) in Reference Genome:


ACAACCTGCTTTTCGTGATCGGACAAATGAGCATCATATCCGATCCACACCCTAGCTTTGCTTCTGTTTCACGTATGTATTTATGGTGGTCATACCCATA[T/C]
ATACGATCATACGTACATAGAGGTGAGAAAGTGACACTGGGGAGATCAACTATCACTTTTAAGATCGGTACAAGGTACTGGTACTGTGTGCTGTTTGCAA

Reverse complement sequence

TTGCAAACAGCACACAGTACCAGTACCTTGTACCGATCTTAAAAGTGATAGTTGATCTCCCCAGTGTCACTTTCTCACCTCTATGTACGTATGATCGTAT[A/G]
TATGGGTATGACCACCATAAATACATACGTGAAACAGAAGCAAAGCTAGGGTGTGGATCGGATATGATGCTCATTTGTCCGATCACGAAAAGCAGGTTGT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 80.20% 19.80% 0.00% 0.00% NA
All Indica  2759 85.80% 14.20% 0.00% 0.00% NA
All Japonica  1512 73.70% 26.30% 0.00% 0.00% NA
Aus  269 61.30% 38.70% 0.00% 0.00% NA
Indica I  595 94.10% 5.90% 0.00% 0.00% NA
Indica II  465 86.70% 13.30% 0.00% 0.00% NA
Indica III  913 82.70% 17.30% 0.00% 0.00% NA
Indica Intermediate  786 82.60% 17.40% 0.00% 0.00% NA
Temperate Japonica  767 97.90% 2.10% 0.00% 0.00% NA
Tropical Japonica  504 44.60% 55.40% 0.00% 0.00% NA
Japonica Intermediate  241 57.70% 42.30% 0.00% 0.00% NA
VI/Aromatic  96 74.00% 26.00% 0.00% 0.00% NA
Intermediate  90 80.00% 20.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1217943070 T -> C LOC_Os12g30000.1 upstream_gene_variant ; 2907.0bp to feature; MODIFIER silent_mutation Average:80.989; most accessible tissue: Zhenshan97 flower, score: 96.688 N N N N
vg1217943070 T -> C LOC_Os12g30000-LOC_Os12g30020 intergenic_region ; MODIFIER silent_mutation Average:80.989; most accessible tissue: Zhenshan97 flower, score: 96.688 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1217943070 T C 0.05 0.01 0.03 0.03 0.05 0.05

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1217943070 NA 2.80E-10 mr1023 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217943070 NA 1.11E-11 mr1055 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217943070 NA 9.70E-12 mr1178 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217943070 4.80E-06 4.80E-06 mr1230 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217943070 3.95E-06 3.95E-06 mr1275 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217943070 NA 5.75E-06 mr1304 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217943070 NA 2.06E-06 mr1364 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217943070 NA 4.22E-06 mr1388 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217943070 NA 1.64E-11 mr1390 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217943070 NA 4.46E-06 mr1414 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217943070 4.24E-06 4.24E-06 mr1424 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217943070 NA 4.52E-07 mr1443 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217943070 NA 5.23E-07 mr1489 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217943070 6.13E-06 6.13E-06 mr1564 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217943070 NA 3.70E-08 mr1602 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217943070 4.05E-07 4.05E-07 mr1659 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217943070 NA 5.64E-09 mr1696 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217943070 NA 1.71E-06 mr1697 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217943070 NA 2.19E-06 mr1742 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217943070 6.27E-06 2.34E-07 mr1884 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217943070 NA 5.28E-11 mr1023_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217943070 NA 1.71E-08 mr1489_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251