Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1217923635:

Variant ID: vg1217923635 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 17923635
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, A: 0.00, others allele: 0.00, population size: 236. )

Flanking Sequence (100 bp) in Reference Genome:


AGCTTGGGGACAAACTGAGGTACGACAAGGGTGCTACCGAGATCGAAGTCGGCTTCGCGCGGACGGACGGTGTGGACGGGCGGACGGAGTGGCACGGAAC[G/A]
AAGAAATTCGCAATAAATATGAAAGGCTTGCTAATGAAGTGGCAATCTACCATTGATGGCAAATACTGAAATTTCTCGCCCAAGTTCCAAAGGGAGCAGG

Reverse complement sequence

CCTGCTCCCTTTGGAACTTGGGCGAGAAATTTCAGTATTTGCCATCAATGGTAGATTGCCACTTCATTAGCAAGCCTTTCATATTTATTGCGAATTTCTT[C/T]
GTTCCGTGCCACTCCGTCCGCCCGTCCACACCGTCCGTCCGCGCGAAGCCGACTTCGATCTCGGTAGCACCCTTGTCGTACCTCAGTTTGTCCCCAAGCT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 86.80% 13.20% 0.00% 0.00% NA
All Indica  2759 81.90% 18.10% 0.00% 0.00% NA
All Japonica  1512 92.30% 7.70% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 58.50% 41.50% 0.00% 0.00% NA
Indica II  465 85.60% 14.40% 0.00% 0.00% NA
Indica III  913 91.60% 8.40% 0.00% 0.00% NA
Indica Intermediate  786 86.30% 13.70% 0.00% 0.00% NA
Temperate Japonica  767 99.70% 0.30% 0.00% 0.00% NA
Tropical Japonica  504 79.40% 20.60% 0.00% 0.00% NA
Japonica Intermediate  241 95.40% 4.60% 0.00% 0.00% NA
VI/Aromatic  96 96.90% 3.10% 0.00% 0.00% NA
Intermediate  90 95.60% 4.40% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1217923635 G -> A LOC_Os12g29980.1 downstream_gene_variant ; 4080.0bp to feature; MODIFIER silent_mutation Average:97.867; most accessible tissue: Zhenshan97 panicle, score: 98.901 N N N N
vg1217923635 G -> A LOC_Os12g29990.1 downstream_gene_variant ; 884.0bp to feature; MODIFIER silent_mutation Average:97.867; most accessible tissue: Zhenshan97 panicle, score: 98.901 N N N N
vg1217923635 G -> A LOC_Os12g29980.2 downstream_gene_variant ; 4080.0bp to feature; MODIFIER silent_mutation Average:97.867; most accessible tissue: Zhenshan97 panicle, score: 98.901 N N N N
vg1217923635 G -> A LOC_Os12g29990.4 downstream_gene_variant ; 884.0bp to feature; MODIFIER silent_mutation Average:97.867; most accessible tissue: Zhenshan97 panicle, score: 98.901 N N N N
vg1217923635 G -> A LOC_Os12g29990.2 downstream_gene_variant ; 957.0bp to feature; MODIFIER silent_mutation Average:97.867; most accessible tissue: Zhenshan97 panicle, score: 98.901 N N N N
vg1217923635 G -> A LOC_Os12g29980-LOC_Os12g29990 intergenic_region ; MODIFIER silent_mutation Average:97.867; most accessible tissue: Zhenshan97 panicle, score: 98.901 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1217923635 G A -0.05 -0.05 -0.04 -0.03 -0.04 -0.04

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1217923635 NA 4.93E-06 mr1148 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217923635 1.60E-06 1.60E-06 mr1194 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217923635 NA 6.68E-06 mr1215 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217923635 NA 5.65E-06 mr1254 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217923635 NA 8.02E-11 mr1352 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217923635 NA 6.93E-07 mr1352 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217923635 NA 2.94E-07 mr1364 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217923635 NA 2.43E-07 mr1443 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217923635 NA 1.88E-06 mr1461 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217923635 NA 9.09E-07 mr1511 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217923635 NA 4.06E-06 mr1685 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217923635 2.73E-06 2.73E-06 mr1849 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217923635 1.71E-06 1.71E-06 mr1849 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217923635 NA 4.62E-06 mr1884 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217923635 NA 8.08E-07 mr1170_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217923635 NA 6.61E-06 mr1194_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217923635 NA 3.30E-06 mr1215_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217923635 NA 4.43E-06 mr1220_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217923635 NA 6.50E-10 mr1227_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217923635 NA 7.10E-08 mr1227_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217923635 2.62E-06 1.12E-08 mr1235_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217923635 NA 1.09E-06 mr1308_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217923635 NA 1.39E-06 mr1498_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217923635 NA 1.35E-08 mr1583_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217923635 NA 4.92E-06 mr1849_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217923635 NA 1.01E-07 mr1849_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251