\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1217913079:

Variant ID: vg1217913079 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 17913079
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 291. )

Flanking Sequence (100 bp) in Reference Genome:


TATTTATATTAAATTAGATAAATATATGTGGTGCATTTGTATCTACGAGCAGTTTGAGTGGTCTTTGTATTCCGAGAAATATTCGTTTTCGTATTCGTGT[C/T]
CGATCATATTCGATCCTTATTCGTATCCGCGATAATTCGTATTCGTTTCCGTATCCGAGTTATTCGTATTCGTTTCCGTATCCGCCTAACAATATGAAAA

Reverse complement sequence

TTTTCATATTGTTAGGCGGATACGGAAACGAATACGAATAACTCGGATACGGAAACGAATACGAATTATCGCGGATACGAATAAGGATCGAATATGATCG[G/A]
ACACGAATACGAAAACGAATATTTCTCGGAATACAAAGACCACTCAAACTGCTCGTAGATACAAATGCACCACATATATTTATCTAATTTAATATAAATA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 86.50% 12.40% 0.32% 0.80% NA
All Indica  2759 81.80% 16.50% 0.47% 1.23% NA
All Japonica  1512 99.20% 0.50% 0.07% 0.26% NA
Aus  269 65.40% 34.20% 0.37% 0.00% NA
Indica I  595 58.80% 41.20% 0.00% 0.00% NA
Indica II  465 94.40% 5.60% 0.00% 0.00% NA
Indica III  913 87.40% 9.10% 0.99% 2.52% NA
Indica Intermediate  786 85.10% 13.00% 0.51% 1.40% NA
Temperate Japonica  767 99.70% 0.30% 0.00% 0.00% NA
Tropical Japonica  504 99.40% 0.40% 0.00% 0.20% NA
Japonica Intermediate  241 97.10% 1.20% 0.41% 1.24% NA
VI/Aromatic  96 81.20% 18.80% 0.00% 0.00% NA
Intermediate  90 87.80% 12.20% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1217913079 C -> DEL N N silent_mutation Average:22.058; most accessible tissue: Zhenshan97 panicle, score: 52.263 N N N N
vg1217913079 C -> T LOC_Os12g29960.1 upstream_gene_variant ; 4427.0bp to feature; MODIFIER silent_mutation Average:22.058; most accessible tissue: Zhenshan97 panicle, score: 52.263 N N N N
vg1217913079 C -> T LOC_Os12g29980.1 upstream_gene_variant ; 2564.0bp to feature; MODIFIER silent_mutation Average:22.058; most accessible tissue: Zhenshan97 panicle, score: 52.263 N N N N
vg1217913079 C -> T LOC_Os12g29980.2 upstream_gene_variant ; 2549.0bp to feature; MODIFIER silent_mutation Average:22.058; most accessible tissue: Zhenshan97 panicle, score: 52.263 N N N N
vg1217913079 C -> T LOC_Os12g29970.1 downstream_gene_variant ; 264.0bp to feature; MODIFIER silent_mutation Average:22.058; most accessible tissue: Zhenshan97 panicle, score: 52.263 N N N N
vg1217913079 C -> T LOC_Os12g29970-LOC_Os12g29980 intergenic_region ; MODIFIER silent_mutation Average:22.058; most accessible tissue: Zhenshan97 panicle, score: 52.263 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1217913079 NA 3.67E-06 mr1148 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217913079 7.41E-07 NA mr1308 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217913079 3.69E-06 1.13E-07 mr1308 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217913079 NA 5.07E-06 mr1461 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217913079 3.84E-06 3.84E-06 mr1849 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217913079 NA 1.17E-08 mr1864 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217913079 NA 1.19E-06 mr1308_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217913079 NA 1.83E-06 mr1361_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217913079 NA 1.01E-07 mr1583_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251