Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1217913079:

Variant ID: vg1217913079 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 17913079
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 291. )

Flanking Sequence (100 bp) in Reference Genome:

TATTTATATTAAATTAGATAAATATATGTGGTGCATTTGTATCTACGAGCAGTTTGAGTGGTCTTTGTATTCCGAGAAATATTCGTTTTCGTATTCGTGT[C/T]
CGATCATATTCGATCCTTATTCGTATCCGCGATAATTCGTATTCGTTTCCGTATCCGAGTTATTCGTATTCGTTTCCGTATCCGCCTAACAATATGAAAA

Reverse complement sequence

TTTTCATATTGTTAGGCGGATACGGAAACGAATACGAATAACTCGGATACGGAAACGAATACGAATTATCGCGGATACGAATAAGGATCGAATATGATCG[G/A]
ACACGAATACGAAAACGAATATTTCTCGGAATACAAAGACCACTCAAACTGCTCGTAGATACAAATGCACCACATATATTTATCTAATTTAATATAAATA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	86.50%	12.40%	0.32%	0.80%	NA
All Indica	2759	81.80%	16.50%	0.47%	1.23%	NA
All Japonica	1512	99.20%	0.50%	0.07%	0.26%	NA
Aus	269	65.40%	34.20%	0.37%	0.00%	NA
Indica I	595	58.80%	41.20%	0.00%	0.00%	NA
Indica II	465	94.40%	5.60%	0.00%	0.00%	NA
Indica III	913	87.40%	9.10%	0.99%	2.52%	NA
Indica Intermediate	786	85.10%	13.00%	0.51%	1.40%	NA
Temperate Japonica	767	99.70%	0.30%	0.00%	0.00%	NA
Tropical Japonica	504	99.40%	0.40%	0.00%	0.20%	NA
Japonica Intermediate	241	97.10%	1.20%	0.41%	1.24%	NA
VI/Aromatic	96	81.20%	18.80%	0.00%	0.00%	NA
Intermediate	90	87.80%	12.20%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1217913079	C -> DEL	N	N	silent_mutation	Average:22.058; most accessible tissue: Zhenshan97 panicle, score: 52.263	N	N	N	N
vg1217913079	C -> T	LOC_Os12g29960.1	upstream_gene_variant ; 4427.0bp to feature; MODIFIER	silent_mutation	Average:22.058; most accessible tissue: Zhenshan97 panicle, score: 52.263	N	N	N	N
vg1217913079	C -> T	LOC_Os12g29980.1	upstream_gene_variant ; 2564.0bp to feature; MODIFIER	silent_mutation	Average:22.058; most accessible tissue: Zhenshan97 panicle, score: 52.263	N	N	N	N
vg1217913079	C -> T	LOC_Os12g29980.2	upstream_gene_variant ; 2549.0bp to feature; MODIFIER	silent_mutation	Average:22.058; most accessible tissue: Zhenshan97 panicle, score: 52.263	N	N	N	N
vg1217913079	C -> T	LOC_Os12g29970.1	downstream_gene_variant ; 264.0bp to feature; MODIFIER	silent_mutation	Average:22.058; most accessible tissue: Zhenshan97 panicle, score: 52.263	N	N	N	N
vg1217913079	C -> T	LOC_Os12g29970-LOC_Os12g29980	intergenic_region ; MODIFIER	silent_mutation	Average:22.058; most accessible tissue: Zhenshan97 panicle, score: 52.263	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1217913079	NA	3.67E-06	mr1148	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217913079	7.41E-07	NA	mr1308	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217913079	3.69E-06	1.13E-07	mr1308	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217913079	NA	5.07E-06	mr1461	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217913079	3.84E-06	3.84E-06	mr1849	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217913079	NA	1.17E-08	mr1864	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217913079	NA	1.19E-06	mr1308_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217913079	NA	1.83E-06	mr1361_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217913079	NA	1.01E-07	mr1583_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251