\
| Variant ID: vg1217896822 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 17896822 |
| Reference Allele: G | Alternative Allele: A,T |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.92, A: 0.08, others allele: 0.00, population size: 89. )
TTAGTTCACACTAAAATTAAAAGTTTGGTTGAAATTGGAACGATGTGACGAAAAAGTTGGAAGATTGTGTGTAAGAAAGTTTTGATGTGATGAAAAAGTT[G/A,T]
GAAGTTTGAATAATTATTTTGAAACTAAACACGGCCCTATATATGGTGTCCTTTTTTCTAGACTATCTATTTATGTTGAATTCTTAACCATAAGTCCATT
AATGGACTTATGGTTAAGAATTCAACATAAATAGATAGTCTAGAAAAAAGGACACCATATATAGGGCCGTGTTTAGTTTCAAAATAATTATTCAAACTTC[C/T,A]
AACTTTTTCATCACATCAAAACTTTCTTACACACAATCTTCCAACTTTTTCGTCACATCGTTCCAATTTCAACCAAACTTTTAATTTTAGTGTGAACTAA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 54.00% | 45.30% | 0.42% | 0.00% | T: 0.34% |
| All Indica | 2759 | 43.50% | 55.40% | 0.47% | 0.00% | T: 0.58% |
| All Japonica | 1512 | 72.10% | 27.70% | 0.20% | 0.00% | NA |
| Aus | 269 | 48.30% | 51.70% | 0.00% | 0.00% | NA |
| Indica I | 595 | 49.20% | 50.30% | 0.50% | 0.00% | NA |
| Indica II | 465 | 30.50% | 68.40% | 1.08% | 0.00% | NA |
| Indica III | 913 | 40.40% | 57.80% | 0.11% | 0.00% | T: 1.64% |
| Indica Intermediate | 786 | 50.50% | 48.90% | 0.51% | 0.00% | T: 0.13% |
| Temperate Japonica | 767 | 96.10% | 3.70% | 0.26% | 0.00% | NA |
| Tropical Japonica | 504 | 42.90% | 57.10% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 56.80% | 42.70% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 72.90% | 27.10% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 65.60% | 30.00% | 4.44% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1217896822 | G -> A | LOC_Os12g29950.1 | upstream_gene_variant ; 4108.0bp to feature; MODIFIER | silent_mutation | Average:61.592; most accessible tissue: Zhenshan97 panicle, score: 87.126 | N | N | N | N |
| vg1217896822 | G -> A | LOC_Os12g29950.2 | upstream_gene_variant ; 4108.0bp to feature; MODIFIER | silent_mutation | Average:61.592; most accessible tissue: Zhenshan97 panicle, score: 87.126 | N | N | N | N |
| vg1217896822 | G -> A | LOC_Os12g29940.1 | downstream_gene_variant ; 2265.0bp to feature; MODIFIER | silent_mutation | Average:61.592; most accessible tissue: Zhenshan97 panicle, score: 87.126 | N | N | N | N |
| vg1217896822 | G -> A | LOC_Os12g29940-LOC_Os12g29950 | intergenic_region ; MODIFIER | silent_mutation | Average:61.592; most accessible tissue: Zhenshan97 panicle, score: 87.126 | N | N | N | N |
| vg1217896822 | G -> T | LOC_Os12g29950.1 | upstream_gene_variant ; 4108.0bp to feature; MODIFIER | silent_mutation | Average:61.592; most accessible tissue: Zhenshan97 panicle, score: 87.126 | N | N | N | N |
| vg1217896822 | G -> T | LOC_Os12g29950.2 | upstream_gene_variant ; 4108.0bp to feature; MODIFIER | silent_mutation | Average:61.592; most accessible tissue: Zhenshan97 panicle, score: 87.126 | N | N | N | N |
| vg1217896822 | G -> T | LOC_Os12g29940.1 | downstream_gene_variant ; 2265.0bp to feature; MODIFIER | silent_mutation | Average:61.592; most accessible tissue: Zhenshan97 panicle, score: 87.126 | N | N | N | N |
| vg1217896822 | G -> T | LOC_Os12g29940-LOC_Os12g29950 | intergenic_region ; MODIFIER | silent_mutation | Average:61.592; most accessible tissue: Zhenshan97 panicle, score: 87.126 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1217896822 | NA | 2.14E-07 | mr1180 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217896822 | NA | 8.90E-07 | mr1183 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217896822 | NA | 5.33E-06 | mr1207 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217896822 | 8.20E-06 | 8.22E-06 | mr1214 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217896822 | NA | 1.74E-07 | mr1215 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217896822 | NA | 2.17E-07 | mr1220 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217896822 | 1.73E-06 | 6.12E-06 | mr1230 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217896822 | NA | 6.25E-06 | mr1327 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217896822 | 5.62E-06 | NA | mr1330 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217896822 | NA | 1.75E-07 | mr1364 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217896822 | NA | 5.83E-06 | mr1388 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217896822 | NA | 5.64E-08 | mr1424 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217896822 | NA | 3.34E-08 | mr1443 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217896822 | NA | 4.41E-06 | mr1461 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217896822 | NA | 3.50E-07 | mr1503 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217896822 | NA | 5.50E-07 | mr1511 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217896822 | NA | 3.78E-06 | mr1564 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217896822 | 5.75E-06 | 5.75E-06 | mr1564 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217896822 | 1.80E-06 | NA | mr1601 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217896822 | NA | 2.34E-07 | mr1602 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217896822 | NA | 8.89E-07 | mr1627 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217896822 | 7.20E-06 | NA | mr1635 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217896822 | NA | 6.96E-06 | mr1642 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217896822 | 9.80E-06 | 3.71E-09 | mr1659 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217896822 | NA | 4.33E-08 | mr1696 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217896822 | NA | 1.31E-06 | mr1742 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217896822 | NA | 2.88E-06 | mr1791 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217896822 | NA | 5.14E-07 | mr1881 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217896822 | NA | 8.95E-07 | mr1884 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217896822 | NA | 5.48E-06 | mr1948 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217896822 | NA | 3.52E-07 | mr1183_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217896822 | NA | 2.49E-07 | mr1653_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |