\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1217896822:

Variant ID: vg1217896822 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 17896822
Reference Allele: GAlternative Allele: A,T
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.92, A: 0.08, others allele: 0.00, population size: 89. )

Flanking Sequence (100 bp) in Reference Genome:


TTAGTTCACACTAAAATTAAAAGTTTGGTTGAAATTGGAACGATGTGACGAAAAAGTTGGAAGATTGTGTGTAAGAAAGTTTTGATGTGATGAAAAAGTT[G/A,T]
GAAGTTTGAATAATTATTTTGAAACTAAACACGGCCCTATATATGGTGTCCTTTTTTCTAGACTATCTATTTATGTTGAATTCTTAACCATAAGTCCATT

Reverse complement sequence

AATGGACTTATGGTTAAGAATTCAACATAAATAGATAGTCTAGAAAAAAGGACACCATATATAGGGCCGTGTTTAGTTTCAAAATAATTATTCAAACTTC[C/T,A]
AACTTTTTCATCACATCAAAACTTTCTTACACACAATCTTCCAACTTTTTCGTCACATCGTTCCAATTTCAACCAAACTTTTAATTTTAGTGTGAACTAA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 54.00% 45.30% 0.42% 0.00% T: 0.34%
All Indica  2759 43.50% 55.40% 0.47% 0.00% T: 0.58%
All Japonica  1512 72.10% 27.70% 0.20% 0.00% NA
Aus  269 48.30% 51.70% 0.00% 0.00% NA
Indica I  595 49.20% 50.30% 0.50% 0.00% NA
Indica II  465 30.50% 68.40% 1.08% 0.00% NA
Indica III  913 40.40% 57.80% 0.11% 0.00% T: 1.64%
Indica Intermediate  786 50.50% 48.90% 0.51% 0.00% T: 0.13%
Temperate Japonica  767 96.10% 3.70% 0.26% 0.00% NA
Tropical Japonica  504 42.90% 57.10% 0.00% 0.00% NA
Japonica Intermediate  241 56.80% 42.70% 0.41% 0.00% NA
VI/Aromatic  96 72.90% 27.10% 0.00% 0.00% NA
Intermediate  90 65.60% 30.00% 4.44% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1217896822 G -> A LOC_Os12g29950.1 upstream_gene_variant ; 4108.0bp to feature; MODIFIER silent_mutation Average:61.592; most accessible tissue: Zhenshan97 panicle, score: 87.126 N N N N
vg1217896822 G -> A LOC_Os12g29950.2 upstream_gene_variant ; 4108.0bp to feature; MODIFIER silent_mutation Average:61.592; most accessible tissue: Zhenshan97 panicle, score: 87.126 N N N N
vg1217896822 G -> A LOC_Os12g29940.1 downstream_gene_variant ; 2265.0bp to feature; MODIFIER silent_mutation Average:61.592; most accessible tissue: Zhenshan97 panicle, score: 87.126 N N N N
vg1217896822 G -> A LOC_Os12g29940-LOC_Os12g29950 intergenic_region ; MODIFIER silent_mutation Average:61.592; most accessible tissue: Zhenshan97 panicle, score: 87.126 N N N N
vg1217896822 G -> T LOC_Os12g29950.1 upstream_gene_variant ; 4108.0bp to feature; MODIFIER silent_mutation Average:61.592; most accessible tissue: Zhenshan97 panicle, score: 87.126 N N N N
vg1217896822 G -> T LOC_Os12g29950.2 upstream_gene_variant ; 4108.0bp to feature; MODIFIER silent_mutation Average:61.592; most accessible tissue: Zhenshan97 panicle, score: 87.126 N N N N
vg1217896822 G -> T LOC_Os12g29940.1 downstream_gene_variant ; 2265.0bp to feature; MODIFIER silent_mutation Average:61.592; most accessible tissue: Zhenshan97 panicle, score: 87.126 N N N N
vg1217896822 G -> T LOC_Os12g29940-LOC_Os12g29950 intergenic_region ; MODIFIER silent_mutation Average:61.592; most accessible tissue: Zhenshan97 panicle, score: 87.126 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1217896822 NA 2.14E-07 mr1180 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217896822 NA 8.90E-07 mr1183 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217896822 NA 5.33E-06 mr1207 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217896822 8.20E-06 8.22E-06 mr1214 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217896822 NA 1.74E-07 mr1215 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217896822 NA 2.17E-07 mr1220 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217896822 1.73E-06 6.12E-06 mr1230 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217896822 NA 6.25E-06 mr1327 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217896822 5.62E-06 NA mr1330 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217896822 NA 1.75E-07 mr1364 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217896822 NA 5.83E-06 mr1388 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217896822 NA 5.64E-08 mr1424 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217896822 NA 3.34E-08 mr1443 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217896822 NA 4.41E-06 mr1461 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217896822 NA 3.50E-07 mr1503 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217896822 NA 5.50E-07 mr1511 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217896822 NA 3.78E-06 mr1564 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217896822 5.75E-06 5.75E-06 mr1564 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217896822 1.80E-06 NA mr1601 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217896822 NA 2.34E-07 mr1602 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217896822 NA 8.89E-07 mr1627 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217896822 7.20E-06 NA mr1635 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217896822 NA 6.96E-06 mr1642 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217896822 9.80E-06 3.71E-09 mr1659 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217896822 NA 4.33E-08 mr1696 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217896822 NA 1.31E-06 mr1742 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217896822 NA 2.88E-06 mr1791 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217896822 NA 5.14E-07 mr1881 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217896822 NA 8.95E-07 mr1884 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217896822 NA 5.48E-06 mr1948 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217896822 NA 3.52E-07 mr1183_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217896822 NA 2.49E-07 mr1653_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251