\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1217896441:

Variant ID: vg1217896441 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 17896441
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, T: 0.01, others allele: 0.00, population size: 232. )

Flanking Sequence (100 bp) in Reference Genome:


ACAGTAGATTTTCTAACGAGGGAGACCTGACCGCCTGGGAGTGTGACAAACTTGGAAAATTTGGTTTCCATTCTCACCTTGCTTCGGCAACGATTACTCG[C/T]
GAGAGAGCTCACAAACGACTCTGACCTTGTAATTTCGCGCGATTACGTATGGTTATCTGTGGTAACCTCGTAAGAAAACTATTTCGAATTTTAAAAATAT

Reverse complement sequence

ATATTTTTAAAATTCGAAATAGTTTTCTTACGAGGTTACCACAGATAACCATACGTAATCGCGCGAAATTACAAGGTCAGAGTCGTTTGTGAGCTCTCTC[G/A]
CGAGTAATCGTTGCCGAAGCAAGGTGAGAATGGAAACCAAATTTTCCAAGTTTGTCACACTCCCAGGCGGTCAGGTCTCCCTCGTTAGAAAATCTACTGT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 81.40% 18.60% 0.00% 0.00% NA
All Indica  2759 83.00% 17.00% 0.00% 0.00% NA
All Japonica  1512 81.20% 18.80% 0.00% 0.00% NA
Aus  269 66.50% 33.50% 0.00% 0.00% NA
Indica I  595 58.80% 41.20% 0.00% 0.00% NA
Indica II  465 94.20% 5.80% 0.00% 0.00% NA
Indica III  913 90.60% 9.40% 0.00% 0.00% NA
Indica Intermediate  786 86.00% 14.00% 0.00% 0.00% NA
Temperate Japonica  767 97.80% 2.20% 0.00% 0.00% NA
Tropical Japonica  504 64.30% 35.70% 0.00% 0.00% NA
Japonica Intermediate  241 63.50% 36.50% 0.00% 0.00% NA
VI/Aromatic  96 80.20% 19.80% 0.00% 0.00% NA
Intermediate  90 81.10% 18.90% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1217896441 C -> T LOC_Os12g29950.1 upstream_gene_variant ; 4489.0bp to feature; MODIFIER silent_mutation Average:67.042; most accessible tissue: Zhenshan97 root, score: 81.351 N N N N
vg1217896441 C -> T LOC_Os12g29950.2 upstream_gene_variant ; 4489.0bp to feature; MODIFIER silent_mutation Average:67.042; most accessible tissue: Zhenshan97 root, score: 81.351 N N N N
vg1217896441 C -> T LOC_Os12g29940.1 downstream_gene_variant ; 1884.0bp to feature; MODIFIER silent_mutation Average:67.042; most accessible tissue: Zhenshan97 root, score: 81.351 N N N N
vg1217896441 C -> T LOC_Os12g29940-LOC_Os12g29950 intergenic_region ; MODIFIER silent_mutation Average:67.042; most accessible tissue: Zhenshan97 root, score: 81.351 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1217896441 NA 8.71E-06 mr1215 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217896441 NA 9.56E-06 mr1308 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217896441 4.29E-06 NA mr1422 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217896441 NA 4.38E-06 mr1461 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217896441 NA 1.87E-06 mr1583 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217896441 NA 2.91E-06 mr1772 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217896441 NA 1.70E-06 mr1864 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217896441 NA 1.07E-06 mr1308_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217896441 NA 4.08E-06 mr1361_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217896441 NA 3.17E-08 mr1583_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217896441 NA 5.71E-06 mr1849_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251