Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1217896441:

Variant ID: vg1217896441 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 17896441
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, T: 0.01, others allele: 0.00, population size: 232. )

Flanking Sequence (100 bp) in Reference Genome:

ACAGTAGATTTTCTAACGAGGGAGACCTGACCGCCTGGGAGTGTGACAAACTTGGAAAATTTGGTTTCCATTCTCACCTTGCTTCGGCAACGATTACTCG[C/T]
GAGAGAGCTCACAAACGACTCTGACCTTGTAATTTCGCGCGATTACGTATGGTTATCTGTGGTAACCTCGTAAGAAAACTATTTCGAATTTTAAAAATAT

Reverse complement sequence

ATATTTTTAAAATTCGAAATAGTTTTCTTACGAGGTTACCACAGATAACCATACGTAATCGCGCGAAATTACAAGGTCAGAGTCGTTTGTGAGCTCTCTC[G/A]
CGAGTAATCGTTGCCGAAGCAAGGTGAGAATGGAAACCAAATTTTCCAAGTTTGTCACACTCCCAGGCGGTCAGGTCTCCCTCGTTAGAAAATCTACTGT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	81.40%	18.60%	0.00%	0.00%	NA
All Indica	2759	83.00%	17.00%	0.00%	0.00%	NA
All Japonica	1512	81.20%	18.80%	0.00%	0.00%	NA
Aus	269	66.50%	33.50%	0.00%	0.00%	NA
Indica I	595	58.80%	41.20%	0.00%	0.00%	NA
Indica II	465	94.20%	5.80%	0.00%	0.00%	NA
Indica III	913	90.60%	9.40%	0.00%	0.00%	NA
Indica Intermediate	786	86.00%	14.00%	0.00%	0.00%	NA
Temperate Japonica	767	97.80%	2.20%	0.00%	0.00%	NA
Tropical Japonica	504	64.30%	35.70%	0.00%	0.00%	NA
Japonica Intermediate	241	63.50%	36.50%	0.00%	0.00%	NA
VI/Aromatic	96	80.20%	19.80%	0.00%	0.00%	NA
Intermediate	90	81.10%	18.90%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1217896441	C -> T	LOC_Os12g29950.1	upstream_gene_variant ; 4489.0bp to feature; MODIFIER	silent_mutation	Average:67.042; most accessible tissue: Zhenshan97 root, score: 81.351	N	N	N	N
vg1217896441	C -> T	LOC_Os12g29950.2	upstream_gene_variant ; 4489.0bp to feature; MODIFIER	silent_mutation	Average:67.042; most accessible tissue: Zhenshan97 root, score: 81.351	N	N	N	N
vg1217896441	C -> T	LOC_Os12g29940.1	downstream_gene_variant ; 1884.0bp to feature; MODIFIER	silent_mutation	Average:67.042; most accessible tissue: Zhenshan97 root, score: 81.351	N	N	N	N
vg1217896441	C -> T	LOC_Os12g29940-LOC_Os12g29950	intergenic_region ; MODIFIER	silent_mutation	Average:67.042; most accessible tissue: Zhenshan97 root, score: 81.351	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1217896441	NA	8.71E-06	mr1215	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217896441	NA	9.56E-06	mr1308	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217896441	4.29E-06	NA	mr1422	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217896441	NA	4.38E-06	mr1461	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217896441	NA	1.87E-06	mr1583	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217896441	NA	2.91E-06	mr1772	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217896441	NA	1.70E-06	mr1864	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217896441	NA	1.07E-06	mr1308_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217896441	NA	4.08E-06	mr1361_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217896441	NA	3.17E-08	mr1583_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217896441	NA	5.71E-06	mr1849_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251