\
| Variant ID: vg1217896441 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 17896441 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, T: 0.01, others allele: 0.00, population size: 232. )
ACAGTAGATTTTCTAACGAGGGAGACCTGACCGCCTGGGAGTGTGACAAACTTGGAAAATTTGGTTTCCATTCTCACCTTGCTTCGGCAACGATTACTCG[C/T]
GAGAGAGCTCACAAACGACTCTGACCTTGTAATTTCGCGCGATTACGTATGGTTATCTGTGGTAACCTCGTAAGAAAACTATTTCGAATTTTAAAAATAT
ATATTTTTAAAATTCGAAATAGTTTTCTTACGAGGTTACCACAGATAACCATACGTAATCGCGCGAAATTACAAGGTCAGAGTCGTTTGTGAGCTCTCTC[G/A]
CGAGTAATCGTTGCCGAAGCAAGGTGAGAATGGAAACCAAATTTTCCAAGTTTGTCACACTCCCAGGCGGTCAGGTCTCCCTCGTTAGAAAATCTACTGT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 81.40% | 18.60% | 0.00% | 0.00% | NA |
| All Indica | 2759 | 83.00% | 17.00% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 81.20% | 18.80% | 0.00% | 0.00% | NA |
| Aus | 269 | 66.50% | 33.50% | 0.00% | 0.00% | NA |
| Indica I | 595 | 58.80% | 41.20% | 0.00% | 0.00% | NA |
| Indica II | 465 | 94.20% | 5.80% | 0.00% | 0.00% | NA |
| Indica III | 913 | 90.60% | 9.40% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 86.00% | 14.00% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 97.80% | 2.20% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 64.30% | 35.70% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 63.50% | 36.50% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 80.20% | 19.80% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 81.10% | 18.90% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1217896441 | C -> T | LOC_Os12g29950.1 | upstream_gene_variant ; 4489.0bp to feature; MODIFIER | silent_mutation | Average:67.042; most accessible tissue: Zhenshan97 root, score: 81.351 | N | N | N | N |
| vg1217896441 | C -> T | LOC_Os12g29950.2 | upstream_gene_variant ; 4489.0bp to feature; MODIFIER | silent_mutation | Average:67.042; most accessible tissue: Zhenshan97 root, score: 81.351 | N | N | N | N |
| vg1217896441 | C -> T | LOC_Os12g29940.1 | downstream_gene_variant ; 1884.0bp to feature; MODIFIER | silent_mutation | Average:67.042; most accessible tissue: Zhenshan97 root, score: 81.351 | N | N | N | N |
| vg1217896441 | C -> T | LOC_Os12g29940-LOC_Os12g29950 | intergenic_region ; MODIFIER | silent_mutation | Average:67.042; most accessible tissue: Zhenshan97 root, score: 81.351 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1217896441 | NA | 8.71E-06 | mr1215 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217896441 | NA | 9.56E-06 | mr1308 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217896441 | 4.29E-06 | NA | mr1422 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217896441 | NA | 4.38E-06 | mr1461 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217896441 | NA | 1.87E-06 | mr1583 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217896441 | NA | 2.91E-06 | mr1772 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217896441 | NA | 1.70E-06 | mr1864 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217896441 | NA | 1.07E-06 | mr1308_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217896441 | NA | 4.08E-06 | mr1361_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217896441 | NA | 3.17E-08 | mr1583_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217896441 | NA | 5.71E-06 | mr1849_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |