\
| Variant ID: vg1217880052 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 17880052 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
TTGAGCAAACTTTCAAAACGTGATCTAGTTGTGGGCTTGAAAGATGTGAAGTTTGAGAAGGATAAGCTTTGTAGTGCTTGTCAAGCCGGCAAGCAAGTTG[C/T]
ATGTTTTCATCCTACTAAGAGTATCATGTCCACATCTAGACCATTGGAGCTTTTGCATATGGATTTGTTTGGCCCAACAACCTACAAGAGCATTGGTGGT
ACCACCAATGCTCTTGTAGGTTGTTGGGCCAAACAAATCCATATGCAAAAGCTCCAATGGTCTAGATGTGGACATGATACTCTTAGTAGGATGAAAACAT[G/A]
CAACTTGCTTGCCGGCTTGACAAGCACTACAAAGCTTATCCTTCTCAAACTTCACATCTTTCAAGCCCACAACTAGATCACGTTTTGAAAGTTTGCTCAA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 58.00% | 0.40% | 1.14% | 40.44% | NA |
| All Indica | 2759 | 51.60% | 0.00% | 0.76% | 47.59% | NA |
| All Japonica | 1512 | 69.00% | 1.30% | 1.92% | 27.71% | NA |
| Aus | 269 | 64.30% | 0.00% | 0.74% | 34.94% | NA |
| Indica I | 595 | 58.70% | 0.00% | 1.01% | 40.34% | NA |
| Indica II | 465 | 34.40% | 0.00% | 1.08% | 64.52% | NA |
| Indica III | 913 | 49.70% | 0.00% | 0.33% | 49.95% | NA |
| Indica Intermediate | 786 | 58.80% | 0.00% | 0.89% | 40.33% | NA |
| Temperate Japonica | 767 | 93.40% | 2.50% | 1.96% | 2.22% | NA |
| Tropical Japonica | 504 | 41.50% | 0.00% | 1.39% | 57.14% | NA |
| Japonica Intermediate | 241 | 49.40% | 0.40% | 2.90% | 47.30% | NA |
| VI/Aromatic | 96 | 39.60% | 0.00% | 0.00% | 60.42% | NA |
| Intermediate | 90 | 66.70% | 1.10% | 2.22% | 30.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1217880052 | C -> DEL | N | N | silent_mutation | Average:7.224; most accessible tissue: Callus, score: 20.289 | N | N | N | N |
| vg1217880052 | C -> T | LOC_Os12g29920.1 | upstream_gene_variant ; 3001.0bp to feature; MODIFIER | silent_mutation | Average:7.224; most accessible tissue: Callus, score: 20.289 | N | N | N | N |
| vg1217880052 | C -> T | LOC_Os12g29910.1 | intron_variant ; MODIFIER | silent_mutation | Average:7.224; most accessible tissue: Callus, score: 20.289 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1217880052 | 8.11E-07 | 8.10E-07 | mr1343 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217880052 | NA | 7.78E-07 | mr1354 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217880052 | NA | 6.26E-06 | mr1829 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217880052 | NA | 4.66E-06 | mr1354_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217880052 | NA | 7.33E-06 | mr1829_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |