\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1217880052:

Variant ID: vg1217880052 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 17880052
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTGAGCAAACTTTCAAAACGTGATCTAGTTGTGGGCTTGAAAGATGTGAAGTTTGAGAAGGATAAGCTTTGTAGTGCTTGTCAAGCCGGCAAGCAAGTTG[C/T]
ATGTTTTCATCCTACTAAGAGTATCATGTCCACATCTAGACCATTGGAGCTTTTGCATATGGATTTGTTTGGCCCAACAACCTACAAGAGCATTGGTGGT

Reverse complement sequence

ACCACCAATGCTCTTGTAGGTTGTTGGGCCAAACAAATCCATATGCAAAAGCTCCAATGGTCTAGATGTGGACATGATACTCTTAGTAGGATGAAAACAT[G/A]
CAACTTGCTTGCCGGCTTGACAAGCACTACAAAGCTTATCCTTCTCAAACTTCACATCTTTCAAGCCCACAACTAGATCACGTTTTGAAAGTTTGCTCAA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 58.00% 0.40% 1.14% 40.44% NA
All Indica  2759 51.60% 0.00% 0.76% 47.59% NA
All Japonica  1512 69.00% 1.30% 1.92% 27.71% NA
Aus  269 64.30% 0.00% 0.74% 34.94% NA
Indica I  595 58.70% 0.00% 1.01% 40.34% NA
Indica II  465 34.40% 0.00% 1.08% 64.52% NA
Indica III  913 49.70% 0.00% 0.33% 49.95% NA
Indica Intermediate  786 58.80% 0.00% 0.89% 40.33% NA
Temperate Japonica  767 93.40% 2.50% 1.96% 2.22% NA
Tropical Japonica  504 41.50% 0.00% 1.39% 57.14% NA
Japonica Intermediate  241 49.40% 0.40% 2.90% 47.30% NA
VI/Aromatic  96 39.60% 0.00% 0.00% 60.42% NA
Intermediate  90 66.70% 1.10% 2.22% 30.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1217880052 C -> DEL N N silent_mutation Average:7.224; most accessible tissue: Callus, score: 20.289 N N N N
vg1217880052 C -> T LOC_Os12g29920.1 upstream_gene_variant ; 3001.0bp to feature; MODIFIER silent_mutation Average:7.224; most accessible tissue: Callus, score: 20.289 N N N N
vg1217880052 C -> T LOC_Os12g29910.1 intron_variant ; MODIFIER silent_mutation Average:7.224; most accessible tissue: Callus, score: 20.289 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1217880052 8.11E-07 8.10E-07 mr1343 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217880052 NA 7.78E-07 mr1354 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217880052 NA 6.26E-06 mr1829 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217880052 NA 4.66E-06 mr1354_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217880052 NA 7.33E-06 mr1829_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251