\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1217863038:

Variant ID: vg1217863038 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 17863038
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATGTCCGAAAGTGATTTTCGGACTTTCCGAAAAGGACTGCGAAGGCAAAAGTGGTTCTGTATATTTTCGGACTTGTTCGAAACTGATTTTCGGATCTTTC[C/T]
GAAAATCATCAGTAGAGTCAATTTCGCTTCTGTATATTTTCGGACTTGTCCGAAAGTTATTTTCGGACTTTTCCGAGAACATCTAGAACGATGTTGTTGG

Reverse complement sequence

CCAACAACATCGTTCTAGATGTTCTCGGAAAAGTCCGAAAATAACTTTCGGACAAGTCCGAAAATATACAGAAGCGAAATTGACTCTACTGATGATTTTC[G/A]
GAAAGATCCGAAAATCAGTTTCGAACAAGTCCGAAAATATACAGAACCACTTTTGCCTTCGCAGTCCTTTTCGGAAAGTCCGAAAATCACTTTCGGACAT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 84.50% 0.30% 3.43% 11.81% NA
All Indica  2759 84.70% 0.40% 3.55% 11.27% NA
All Japonica  1512 81.90% 0.00% 3.37% 14.68% NA
Aus  269 94.80% 0.40% 1.49% 3.35% NA
Indica I  595 97.50% 0.20% 1.51% 0.84% NA
Indica II  465 73.50% 0.00% 4.73% 21.72% NA
Indica III  913 79.80% 1.10% 4.82% 14.24% NA
Indica Intermediate  786 87.40% 0.10% 2.93% 9.54% NA
Temperate Japonica  767 98.60% 0.00% 0.13% 1.30% NA
Tropical Japonica  504 59.90% 0.00% 7.34% 32.74% NA
Japonica Intermediate  241 75.10% 0.00% 5.39% 19.50% NA
VI/Aromatic  96 81.20% 0.00% 6.25% 12.50% NA
Intermediate  90 91.10% 1.10% 3.33% 4.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1217863038 C -> DEL N N silent_mutation Average:11.829; most accessible tissue: Zhenshan97 root, score: 20.427 N N N N
vg1217863038 C -> T LOC_Os12g29874.1 upstream_gene_variant ; 1117.0bp to feature; MODIFIER silent_mutation Average:11.829; most accessible tissue: Zhenshan97 root, score: 20.427 N N N N
vg1217863038 C -> T LOC_Os12g29860.1 downstream_gene_variant ; 835.0bp to feature; MODIFIER silent_mutation Average:11.829; most accessible tissue: Zhenshan97 root, score: 20.427 N N N N
vg1217863038 C -> T LOC_Os12g29860-LOC_Os12g29874 intergenic_region ; MODIFIER silent_mutation Average:11.829; most accessible tissue: Zhenshan97 root, score: 20.427 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1217863038 NA 7.22E-06 mr1073 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217863038 2.91E-08 2.91E-08 mr1266 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217863038 8.95E-07 8.95E-07 mr1275 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217863038 NA 9.37E-06 mr1304 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217863038 6.31E-06 6.31E-06 mr1307 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217863038 2.62E-06 2.62E-06 mr1347 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217863038 NA 9.03E-06 mr1350 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217863038 5.39E-06 5.39E-06 mr1361 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217863038 NA 7.69E-06 mr1382 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217863038 NA 8.36E-06 mr1388 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217863038 5.30E-06 5.30E-06 mr1407 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217863038 NA 2.42E-06 mr1414 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217863038 NA 4.52E-06 mr1557 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217863038 NA 2.30E-06 mr1578 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217863038 NA 8.71E-07 mr1584 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217863038 4.12E-06 4.11E-06 mr1601 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217863038 NA 1.97E-06 mr1607 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217863038 9.20E-06 9.20E-06 mr1659 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217863038 NA 2.64E-08 mr1695 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217863038 NA 5.96E-08 mr1819 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251