Variant ID: vg1217862937 (JBrowse) | Variation Type: SNP |
Chromosome: chr12 | Position: 17862937 |
Reference Allele: T | Alternative Allele: C |
Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
AGTTTGGTGTGTTTTGGATTTTTTCGGAGTTTTCTGAAACTCATTTTCGGACTTTCCGAAAACACACAGAACCAGATTTTCGCTTCTGGAAATTTTTGGA[T/C]
ATGTCCGAAAGTGATTTTCGGACTTTCCGAAAAGGACTGCGAAGGCAAAAGTGGTTCTGTATATTTTCGGACTTGTTCGAAACTGATTTTCGGATCTTTC
GAAAGATCCGAAAATCAGTTTCGAACAAGTCCGAAAATATACAGAACCACTTTTGCCTTCGCAGTCCTTTTCGGAAAGTCCGAAAATCACTTTCGGACAT[A/G]
TCCAAAAATTTCCAGAAGCGAAAATCTGGTTCTGTGTGTTTTCGGAAAGTCCGAAAATGAGTTTCAGAAAACTCCGAAAAAATCCAAAACACACCAAACT
Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 72.00% | 3.20% | 0.99% | 23.76% | NA |
All Indica | 2759 | 71.60% | 3.90% | 1.30% | 23.20% | NA |
All Japonica | 1512 | 75.80% | 2.80% | 0.60% | 20.77% | NA |
Aus | 269 | 61.00% | 0.00% | 0.74% | 38.29% | NA |
Indica I | 595 | 93.80% | 0.30% | 0.00% | 5.88% | NA |
Indica II | 465 | 60.20% | 0.90% | 1.29% | 37.63% | NA |
Indica III | 913 | 59.50% | 7.60% | 2.63% | 30.34% | NA |
Indica Intermediate | 786 | 75.70% | 4.10% | 0.76% | 19.47% | NA |
Temperate Japonica | 767 | 98.00% | 0.00% | 0.00% | 1.96% | NA |
Tropical Japonica | 504 | 47.80% | 7.90% | 1.59% | 42.66% | NA |
Japonica Intermediate | 241 | 63.50% | 1.20% | 0.41% | 34.85% | NA |
VI/Aromatic | 96 | 47.90% | 0.00% | 0.00% | 52.08% | NA |
Intermediate | 90 | 81.10% | 1.10% | 0.00% | 17.78% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg1217862937 | T -> C | LOC_Os12g29874.1 | upstream_gene_variant ; 1218.0bp to feature; MODIFIER | silent_mutation | Average:12.916; most accessible tissue: Zhenshan97 root, score: 22.162 | N | N | N | N |
vg1217862937 | T -> C | LOC_Os12g29860.1 | downstream_gene_variant ; 734.0bp to feature; MODIFIER | silent_mutation | Average:12.916; most accessible tissue: Zhenshan97 root, score: 22.162 | N | N | N | N |
vg1217862937 | T -> C | LOC_Os12g29860-LOC_Os12g29874 | intergenic_region ; MODIFIER | silent_mutation | Average:12.916; most accessible tissue: Zhenshan97 root, score: 22.162 | N | N | N | N |
vg1217862937 | T -> DEL | N | N | silent_mutation | Average:12.916; most accessible tissue: Zhenshan97 root, score: 22.162 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg1217862937 | 8.97E-06 | 8.66E-07 | mr1039 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1217862937 | NA | 1.24E-06 | mr1114 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1217862937 | NA | 4.39E-06 | mr1116 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1217862937 | 6.02E-06 | 6.02E-06 | mr1266 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1217862937 | 8.43E-06 | 8.43E-06 | mr1275 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1217862937 | NA | 6.01E-06 | mr1345 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1217862937 | 8.04E-07 | 8.04E-07 | mr1365 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1217862937 | NA | 2.60E-06 | mr1695 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1217862937 | 9.00E-07 | 9.00E-07 | mr1823 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1217862937 | 2.59E-07 | 2.59E-07 | mr1876 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |