Search for Variation information by Variation ID:
Detailed information for vg1217860400:
| Variant ID: vg1217860400 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 17860400 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
Flanking Sequence (100 bp) in Reference Genome:
ACAACGAGGTGCCGTGAAGAAGCTAGAGGGTTGGCACATCATAACGGAAGTGGACGAAGAGGGCCGACCTAGTGCCCCGGCAGAAGCAGCCAAGAACTAC[G/A]
TACGACACAGCGGTTGGGTTGTGCGGGATAACGTGCCTGTTAGTACGGTGTACAGGCGCAAAACAAGGGCACGCGGAGATCATGAGAGCTTTGTCCCAGA
Reverse complement sequence
TCTGGGACAAAGCTCTCATGATCTCCGCGTGCCCTTGTTTTGCGCCTGTACACCGTACTAACAGGCACGTTATCCCGCACAACCCAACCGCTGTGTCGTA[C/T]
GTAGTTCTTGGCTGCTTCTGCCGGGGCACTAGGTCGGCCCTCTTCGTCCACTTCCGTTATGATGTGCCAACCCTCTAGCTTCTTCACGGCACCTCGTTGT
Allele Frequencies:
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 72.30% | 9.30% | 4.57% | 13.84% | NA |
| All Indica | 2759 | 67.00% | 15.70% | 6.02% | 11.34% | NA |
| All Japonica | 1512 | 77.80% | 0.40% | 2.45% | 19.38% | NA |
| Aus | 269 | 95.50% | 0.00% | 2.23% | 2.23% | NA |
| Indica I | 595 | 55.00% | 39.20% | 1.18% | 4.71% | NA |
| Indica II | 465 | 74.20% | 5.80% | 6.45% | 13.55% | NA |
| Indica III | 913 | 69.70% | 8.30% | 7.67% | 14.35% | NA |
| Indica Intermediate | 786 | 68.70% | 12.20% | 7.51% | 11.58% | NA |
| Temperate Japonica | 767 | 97.50% | 0.30% | 0.26% | 1.96% | NA |
| Tropical Japonica | 504 | 53.00% | 0.60% | 5.36% | 41.07% | NA |
| Japonica Intermediate | 241 | 66.80% | 0.40% | 3.32% | 29.46% | NA |
| VI/Aromatic | 96 | 59.40% | 0.00% | 4.17% | 36.46% | NA |
| Intermediate | 90 | 85.60% | 3.30% | 3.33% | 7.78% | NA |
Allele Effect:
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1217860400 | G -> DEL | LOC_Os12g29860.1 | N | frameshift_variant | Average:22.354; most accessible tissue: Zhenshan97 flag leaf, score: 65.82 | N | N | N | N |
| vg1217860400 | G -> A | LOC_Os12g29860.1 | missense_variant ; p.Val636Ile; MODERATE | nonsynonymous_codon ; V636I | Average:22.354; most accessible tissue: Zhenshan97 flag leaf, score: 65.82 | benign  |
0.601 |
DELETERIOUS | 0.02 |
Putative Genotype-Phenotype Associations:
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1217860400 | 3.09E-06 | NA | mr1651 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217860400 | 6.94E-06 | 6.93E-06 | mr1651 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217860400 | 8.04E-06 | 8.04E-06 | mr1849 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217860400 | NA | 2.65E-06 | mr1308_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217860400 | NA | 4.86E-06 | mr1361_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217860400 | NA | 8.65E-07 | mr1583_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |