Search for Variation information by Variation ID:
Detailed information for vg1217857351:
| Variant ID: vg1217857351 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 17857351 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 108. )
Flanking Sequence (100 bp) in Reference Genome:
ATTCCAGGGATATGAGATCAATGGGTACACATTCTACACGAGAGCCCAAGACATGAAGAGCACGAACCAAAACAGCGTTGTTCGTATCGATGCCATGGGA[T/C]
ACGAAGGAACAACTGGCACGTATTACGGAGCCATCAAGGACATATGGGAACTTGACTATGGTCCTCTCAAGGTCCCTCTGTTCTGGTGCTAATGGGTTAG
Reverse complement sequence
CTAACCCATTAGCACCAGAACAGAGGGACCTTGAGAGGACCATAGTCAAGTTCCCATATGTCCTTGATGGCTCCGTAATACGTGCCAGTTGTTCCTTCGT[A/G]
TCCCATGGCATCGATACGAACAACGCTGTTTTGGTTCGTGCTCTTCATGTCTTGGGCTCTCGTGTAGAATGTGTACCCATTGATCTCATATCCCTGGAAT
Allele Frequencies:
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 48.50% | 21.70% | 0.28% | 29.52% | NA |
| All Indica | 2759 | 61.10% | 8.50% | 0.29% | 30.05% | NA |
| All Japonica | 1512 | 27.60% | 47.60% | 0.20% | 24.60% | NA |
| Aus | 269 | 43.50% | 10.40% | 0.37% | 45.72% | NA |
| Indica I | 595 | 87.10% | 5.00% | 0.17% | 7.73% | NA |
| Indica II | 465 | 32.30% | 24.50% | 0.65% | 42.58% | NA |
| Indica III | 913 | 56.80% | 1.20% | 0.11% | 41.84% | NA |
| Indica Intermediate | 786 | 63.60% | 10.20% | 0.38% | 25.83% | NA |
| Temperate Japonica | 767 | 23.70% | 74.10% | 0.00% | 2.22% | NA |
| Tropical Japonica | 504 | 35.70% | 11.50% | 0.40% | 52.38% | NA |
| Japonica Intermediate | 241 | 22.80% | 39.00% | 0.41% | 37.76% | NA |
| VI/Aromatic | 96 | 35.40% | 10.40% | 0.00% | 54.17% | NA |
| Intermediate | 90 | 43.30% | 34.40% | 1.11% | 21.11% | NA |
Allele Effect:
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1217857351 | T -> C | LOC_Os12g29860.1 | missense_variant ; p.Tyr391His; MODERATE | nonsynonymous_codon ; Y391Q | Average:19.024; most accessible tissue: Zhenshan97 flag leaf, score: 34.199 | possibly damaging  |
1.548 |
DELETERIOUS | 0.00 |
| vg1217857351 | T -> C | LOC_Os12g29860.1 | missense_variant ; p.Tyr391His; MODERATE | nonsynonymous_codon ; Y391H | Average:19.024; most accessible tissue: Zhenshan97 flag leaf, score: 34.199 | benign |
-0.565 |
TOLERATED | 1.00 |
| vg1217857351 | T -> DEL | LOC_Os12g29860.1 | N | frameshift_variant | Average:19.024; most accessible tissue: Zhenshan97 flag leaf, score: 34.199 | N | N | N | N |
Putative Genotype-Phenotype Associations:
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1217857351 | NA | 1.01E-11 | Plant_height | Jap_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg1217857351 | NA | 1.87E-06 | mr1183 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217857351 | NA | 4.29E-06 | mr1503 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217857351 | NA | 3.02E-07 | mr1617 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217857351 | NA | 8.72E-09 | mr1826 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217857351 | NA | 1.97E-06 | mr1332_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217857351 | NA | 6.73E-06 | mr1655_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217857351 | NA | 5.45E-09 | mr1861_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217857351 | NA | 2.99E-06 | mr1910_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |