\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1217824132:

Variant ID: vg1217824132 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 17824132
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.88, T: 0.13, others allele: 0.00, population size: 86. )

Flanking Sequence (100 bp) in Reference Genome:


AGTTAATTTATATACTGCTGGTCAAATCATGAGAGTCTAACCTACCGAGAGTTTTTACATTTAACCCATTTTCTACTTTTTATTTCACGAACCAAATCCC[C/T]
TGAAAAATTTATTGTATGACAAAAATTTTATATCTACCATCGCATAAGATTGGATTCGCTGCAATACCATCACTAAACTCGGCTTTGTTAGACTCTCAAC

Reverse complement sequence

GTTGAGAGTCTAACAAAGCCGAGTTTAGTGATGGTATTGCAGCGAATCCAATCTTATGCGATGGTAGATATAAAATTTTTGTCATACAATAAATTTTTCA[G/A]
GGGATTTGGTTCGTGAAATAAAAAGTAGAAAATGGGTTAAATGTAAAAACTCTCGGTAGGTTAGACTCTCATGATTTGACCAGCAGTATATAAATTAACT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 43.50% 11.30% 0.49% 44.75% NA
All Indica  2759 30.90% 17.20% 0.65% 51.29% NA
All Japonica  1512 65.70% 3.40% 0.13% 30.75% NA
Aus  269 44.60% 0.00% 0.74% 54.65% NA
Indica I  595 19.70% 30.40% 0.84% 49.08% NA
Indica II  465 16.30% 16.30% 0.86% 66.45% NA
Indica III  913 37.90% 11.40% 0.33% 50.38% NA
Indica Intermediate  786 39.80% 14.40% 0.76% 45.04% NA
Temperate Japonica  767 89.40% 6.30% 0.00% 4.30% NA
Tropical Japonica  504 39.70% 0.00% 0.20% 60.12% NA
Japonica Intermediate  241 44.80% 1.20% 0.41% 53.53% NA
VI/Aromatic  96 36.50% 1.00% 1.04% 61.46% NA
Intermediate  90 60.00% 7.80% 0.00% 32.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1217824132 C -> DEL N N silent_mutation Average:9.878; most accessible tissue: Callus, score: 43.722 N N N N
vg1217824132 C -> T LOC_Os12g29820.1 upstream_gene_variant ; 187.0bp to feature; MODIFIER silent_mutation Average:9.878; most accessible tissue: Callus, score: 43.722 N N N N
vg1217824132 C -> T LOC_Os12g29830.1 upstream_gene_variant ; 923.0bp to feature; MODIFIER silent_mutation Average:9.878; most accessible tissue: Callus, score: 43.722 N N N N
vg1217824132 C -> T LOC_Os12g29810.1 downstream_gene_variant ; 4005.0bp to feature; MODIFIER silent_mutation Average:9.878; most accessible tissue: Callus, score: 43.722 N N N N
vg1217824132 C -> T LOC_Os12g29820-LOC_Os12g29830 intergenic_region ; MODIFIER silent_mutation Average:9.878; most accessible tissue: Callus, score: 43.722 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1217824132 7.59E-07 9.71E-14 Awn_length Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1217824132 NA 7.46E-07 mr1274 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217824132 3.23E-06 NA mr1588 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217824132 2.84E-06 NA mr1588 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217824132 NA 5.87E-07 mr1113_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217824132 NA 3.87E-06 mr1128_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217824132 NA 5.69E-06 mr1201_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217824132 NA 1.65E-07 mr1274_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217824132 NA 1.54E-06 mr1528_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251