Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1217824132:

Variant ID: vg1217824132 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 17824132
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.88, T: 0.13, others allele: 0.00, population size: 86. )

Flanking Sequence (100 bp) in Reference Genome:

AGTTAATTTATATACTGCTGGTCAAATCATGAGAGTCTAACCTACCGAGAGTTTTTACATTTAACCCATTTTCTACTTTTTATTTCACGAACCAAATCCC[C/T]
TGAAAAATTTATTGTATGACAAAAATTTTATATCTACCATCGCATAAGATTGGATTCGCTGCAATACCATCACTAAACTCGGCTTTGTTAGACTCTCAAC

Reverse complement sequence

GTTGAGAGTCTAACAAAGCCGAGTTTAGTGATGGTATTGCAGCGAATCCAATCTTATGCGATGGTAGATATAAAATTTTTGTCATACAATAAATTTTTCA[G/A]
GGGATTTGGTTCGTGAAATAAAAAGTAGAAAATGGGTTAAATGTAAAAACTCTCGGTAGGTTAGACTCTCATGATTTGACCAGCAGTATATAAATTAACT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	43.50%	11.30%	0.49%	44.75%	NA
All Indica	2759	30.90%	17.20%	0.65%	51.29%	NA
All Japonica	1512	65.70%	3.40%	0.13%	30.75%	NA
Aus	269	44.60%	0.00%	0.74%	54.65%	NA
Indica I	595	19.70%	30.40%	0.84%	49.08%	NA
Indica II	465	16.30%	16.30%	0.86%	66.45%	NA
Indica III	913	37.90%	11.40%	0.33%	50.38%	NA
Indica Intermediate	786	39.80%	14.40%	0.76%	45.04%	NA
Temperate Japonica	767	89.40%	6.30%	0.00%	4.30%	NA
Tropical Japonica	504	39.70%	0.00%	0.20%	60.12%	NA
Japonica Intermediate	241	44.80%	1.20%	0.41%	53.53%	NA
VI/Aromatic	96	36.50%	1.00%	1.04%	61.46%	NA
Intermediate	90	60.00%	7.80%	0.00%	32.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1217824132	C -> DEL	N	N	silent_mutation	Average:9.878; most accessible tissue: Callus, score: 43.722	N	N	N	N
vg1217824132	C -> T	LOC_Os12g29820.1	upstream_gene_variant ; 187.0bp to feature; MODIFIER	silent_mutation	Average:9.878; most accessible tissue: Callus, score: 43.722	N	N	N	N
vg1217824132	C -> T	LOC_Os12g29830.1	upstream_gene_variant ; 923.0bp to feature; MODIFIER	silent_mutation	Average:9.878; most accessible tissue: Callus, score: 43.722	N	N	N	N
vg1217824132	C -> T	LOC_Os12g29810.1	downstream_gene_variant ; 4005.0bp to feature; MODIFIER	silent_mutation	Average:9.878; most accessible tissue: Callus, score: 43.722	N	N	N	N
vg1217824132	C -> T	LOC_Os12g29820-LOC_Os12g29830	intergenic_region ; MODIFIER	silent_mutation	Average:9.878; most accessible tissue: Callus, score: 43.722	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1217824132	7.59E-07	9.71E-14	Awn_length	Jap_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1217824132	NA	7.46E-07	mr1274	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217824132	3.23E-06	NA	mr1588	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217824132	2.84E-06	NA	mr1588	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217824132	NA	5.87E-07	mr1113_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217824132	NA	3.87E-06	mr1128_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217824132	NA	5.69E-06	mr1201_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217824132	NA	1.65E-07	mr1274_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217824132	NA	1.54E-06	mr1528_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251