\
| Variant ID: vg1217824132 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 17824132 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.88, T: 0.13, others allele: 0.00, population size: 86. )
AGTTAATTTATATACTGCTGGTCAAATCATGAGAGTCTAACCTACCGAGAGTTTTTACATTTAACCCATTTTCTACTTTTTATTTCACGAACCAAATCCC[C/T]
TGAAAAATTTATTGTATGACAAAAATTTTATATCTACCATCGCATAAGATTGGATTCGCTGCAATACCATCACTAAACTCGGCTTTGTTAGACTCTCAAC
GTTGAGAGTCTAACAAAGCCGAGTTTAGTGATGGTATTGCAGCGAATCCAATCTTATGCGATGGTAGATATAAAATTTTTGTCATACAATAAATTTTTCA[G/A]
GGGATTTGGTTCGTGAAATAAAAAGTAGAAAATGGGTTAAATGTAAAAACTCTCGGTAGGTTAGACTCTCATGATTTGACCAGCAGTATATAAATTAACT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 43.50% | 11.30% | 0.49% | 44.75% | NA |
| All Indica | 2759 | 30.90% | 17.20% | 0.65% | 51.29% | NA |
| All Japonica | 1512 | 65.70% | 3.40% | 0.13% | 30.75% | NA |
| Aus | 269 | 44.60% | 0.00% | 0.74% | 54.65% | NA |
| Indica I | 595 | 19.70% | 30.40% | 0.84% | 49.08% | NA |
| Indica II | 465 | 16.30% | 16.30% | 0.86% | 66.45% | NA |
| Indica III | 913 | 37.90% | 11.40% | 0.33% | 50.38% | NA |
| Indica Intermediate | 786 | 39.80% | 14.40% | 0.76% | 45.04% | NA |
| Temperate Japonica | 767 | 89.40% | 6.30% | 0.00% | 4.30% | NA |
| Tropical Japonica | 504 | 39.70% | 0.00% | 0.20% | 60.12% | NA |
| Japonica Intermediate | 241 | 44.80% | 1.20% | 0.41% | 53.53% | NA |
| VI/Aromatic | 96 | 36.50% | 1.00% | 1.04% | 61.46% | NA |
| Intermediate | 90 | 60.00% | 7.80% | 0.00% | 32.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1217824132 | C -> DEL | N | N | silent_mutation | Average:9.878; most accessible tissue: Callus, score: 43.722 | N | N | N | N |
| vg1217824132 | C -> T | LOC_Os12g29820.1 | upstream_gene_variant ; 187.0bp to feature; MODIFIER | silent_mutation | Average:9.878; most accessible tissue: Callus, score: 43.722 | N | N | N | N |
| vg1217824132 | C -> T | LOC_Os12g29830.1 | upstream_gene_variant ; 923.0bp to feature; MODIFIER | silent_mutation | Average:9.878; most accessible tissue: Callus, score: 43.722 | N | N | N | N |
| vg1217824132 | C -> T | LOC_Os12g29810.1 | downstream_gene_variant ; 4005.0bp to feature; MODIFIER | silent_mutation | Average:9.878; most accessible tissue: Callus, score: 43.722 | N | N | N | N |
| vg1217824132 | C -> T | LOC_Os12g29820-LOC_Os12g29830 | intergenic_region ; MODIFIER | silent_mutation | Average:9.878; most accessible tissue: Callus, score: 43.722 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1217824132 | 7.59E-07 | 9.71E-14 | Awn_length | Jap_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg1217824132 | NA | 7.46E-07 | mr1274 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217824132 | 3.23E-06 | NA | mr1588 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217824132 | 2.84E-06 | NA | mr1588 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217824132 | NA | 5.87E-07 | mr1113_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217824132 | NA | 3.87E-06 | mr1128_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217824132 | NA | 5.69E-06 | mr1201_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217824132 | NA | 1.65E-07 | mr1274_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217824132 | NA | 1.54E-06 | mr1528_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |