\
| Variant ID: vg1217808832 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 17808832 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 241. )
GTTAAGCTTAAGGGTAGAGTGACACACATCTAAAGATTTAGGTAACTCCTACATTCTCCTAATTATAGCTAAGTGGTAGTAGTTTAGGTATGTTCCATTC[C/T]
TGTACTTCTAGTATACAACATCTTAGTATATTCTAACTAGTATACACTATGTAGTATAACCCCTTTAACAATGCAGCATAGCTAAGCCTAAGCATAGCTA
TAGCTATGCTTAGGCTTAGCTATGCTGCATTGTTAAAGGGGTTATACTACATAGTGTATACTAGTTAGAATATACTAAGATGTTGTATACTAGAAGTACA[G/A]
GAATGGAACATACCTAAACTACTACCACTTAGCTATAATTAGGAGAATGTAGGAGTTACCTAAATCTTTAGATGTGTGTCACTCTACCCTTAAGCTTAAC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 79.80% | 6.50% | 8.87% | 4.85% | NA |
| All Indica | 2759 | 86.80% | 10.80% | 1.59% | 0.80% | NA |
| All Japonica | 1512 | 72.20% | 0.20% | 14.68% | 12.96% | NA |
| Aus | 269 | 55.80% | 0.70% | 40.52% | 2.97% | NA |
| Indica I | 595 | 88.20% | 7.20% | 2.69% | 1.85% | NA |
| Indica II | 465 | 95.10% | 3.90% | 0.65% | 0.43% | NA |
| Indica III | 913 | 87.50% | 11.30% | 1.20% | 0.00% | NA |
| Indica Intermediate | 786 | 80.20% | 16.90% | 1.78% | 1.15% | NA |
| Temperate Japonica | 767 | 96.50% | 0.10% | 1.17% | 2.22% | NA |
| Tropical Japonica | 504 | 44.60% | 0.00% | 30.75% | 24.60% | NA |
| Japonica Intermediate | 241 | 52.30% | 0.80% | 24.07% | 22.82% | NA |
| VI/Aromatic | 96 | 62.50% | 1.00% | 34.38% | 2.08% | NA |
| Intermediate | 90 | 81.10% | 5.60% | 12.22% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1217808832 | C -> DEL | N | N | silent_mutation | Average:28.418; most accessible tissue: Zhenshan97 flag leaf, score: 63.67 | N | N | N | N |
| vg1217808832 | C -> T | LOC_Os12g29790.1 | upstream_gene_variant ; 3015.0bp to feature; MODIFIER | silent_mutation | Average:28.418; most accessible tissue: Zhenshan97 flag leaf, score: 63.67 | N | N | N | N |
| vg1217808832 | C -> T | LOC_Os12g29800.1 | downstream_gene_variant ; 1710.0bp to feature; MODIFIER | silent_mutation | Average:28.418; most accessible tissue: Zhenshan97 flag leaf, score: 63.67 | N | N | N | N |
| vg1217808832 | C -> T | LOC_Os12g29790-LOC_Os12g29800 | intergenic_region ; MODIFIER | silent_mutation | Average:28.418; most accessible tissue: Zhenshan97 flag leaf, score: 63.67 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1217808832 | 7.07E-06 | 7.07E-06 | mr1321 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217808832 | 6.89E-07 | 6.89E-07 | mr1323 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217808832 | 8.24E-06 | 1.18E-06 | mr1324 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217808832 | NA | 6.21E-07 | mr1325 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217808832 | NA | 1.95E-06 | mr1326 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217808832 | NA | 3.84E-06 | mr1336 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217808832 | 5.78E-06 | 5.78E-06 | mr1338 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217808832 | 9.66E-06 | 3.95E-06 | mr1346 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217808832 | NA | 6.72E-06 | mr1532 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217808832 | 7.41E-07 | 7.41E-07 | mr1540 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217808832 | 4.30E-06 | NA | mr1719 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217808832 | 2.75E-07 | 8.50E-09 | mr1732 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |