\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1217808832:

Variant ID: vg1217808832 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 17808832
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 241. )

Flanking Sequence (100 bp) in Reference Genome:


GTTAAGCTTAAGGGTAGAGTGACACACATCTAAAGATTTAGGTAACTCCTACATTCTCCTAATTATAGCTAAGTGGTAGTAGTTTAGGTATGTTCCATTC[C/T]
TGTACTTCTAGTATACAACATCTTAGTATATTCTAACTAGTATACACTATGTAGTATAACCCCTTTAACAATGCAGCATAGCTAAGCCTAAGCATAGCTA

Reverse complement sequence

TAGCTATGCTTAGGCTTAGCTATGCTGCATTGTTAAAGGGGTTATACTACATAGTGTATACTAGTTAGAATATACTAAGATGTTGTATACTAGAAGTACA[G/A]
GAATGGAACATACCTAAACTACTACCACTTAGCTATAATTAGGAGAATGTAGGAGTTACCTAAATCTTTAGATGTGTGTCACTCTACCCTTAAGCTTAAC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 79.80% 6.50% 8.87% 4.85% NA
All Indica  2759 86.80% 10.80% 1.59% 0.80% NA
All Japonica  1512 72.20% 0.20% 14.68% 12.96% NA
Aus  269 55.80% 0.70% 40.52% 2.97% NA
Indica I  595 88.20% 7.20% 2.69% 1.85% NA
Indica II  465 95.10% 3.90% 0.65% 0.43% NA
Indica III  913 87.50% 11.30% 1.20% 0.00% NA
Indica Intermediate  786 80.20% 16.90% 1.78% 1.15% NA
Temperate Japonica  767 96.50% 0.10% 1.17% 2.22% NA
Tropical Japonica  504 44.60% 0.00% 30.75% 24.60% NA
Japonica Intermediate  241 52.30% 0.80% 24.07% 22.82% NA
VI/Aromatic  96 62.50% 1.00% 34.38% 2.08% NA
Intermediate  90 81.10% 5.60% 12.22% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1217808832 C -> DEL N N silent_mutation Average:28.418; most accessible tissue: Zhenshan97 flag leaf, score: 63.67 N N N N
vg1217808832 C -> T LOC_Os12g29790.1 upstream_gene_variant ; 3015.0bp to feature; MODIFIER silent_mutation Average:28.418; most accessible tissue: Zhenshan97 flag leaf, score: 63.67 N N N N
vg1217808832 C -> T LOC_Os12g29800.1 downstream_gene_variant ; 1710.0bp to feature; MODIFIER silent_mutation Average:28.418; most accessible tissue: Zhenshan97 flag leaf, score: 63.67 N N N N
vg1217808832 C -> T LOC_Os12g29790-LOC_Os12g29800 intergenic_region ; MODIFIER silent_mutation Average:28.418; most accessible tissue: Zhenshan97 flag leaf, score: 63.67 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1217808832 7.07E-06 7.07E-06 mr1321 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217808832 6.89E-07 6.89E-07 mr1323 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217808832 8.24E-06 1.18E-06 mr1324 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217808832 NA 6.21E-07 mr1325 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217808832 NA 1.95E-06 mr1326 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217808832 NA 3.84E-06 mr1336 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217808832 5.78E-06 5.78E-06 mr1338 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217808832 9.66E-06 3.95E-06 mr1346 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217808832 NA 6.72E-06 mr1532 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217808832 7.41E-07 7.41E-07 mr1540 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217808832 4.30E-06 NA mr1719 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217808832 2.75E-07 8.50E-09 mr1732 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251