\
| Variant ID: vg1217798279 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 17798279 |
| Reference Allele: G | Alternative Allele: C |
| Primary Allele: G | Secondary Allele: C |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.89, C: 0.11, others allele: 0.00, population size: 65. )
TTGATAATTACACAGTACGATGCAGATACTCATAATGCATGCGCACTTACCCCTATAAACGCATGCACGCAAACCCTACCCCTATGATCACATTCGAAGA[G/C]
TAGGCCGGCAAATCCTTGAAATTGACGAAGTCACCATAGGCACCTCGTTGTTGCCTACCACTGAAAGCACACCGCCATTAAATCCTGGAAAATTTGCTCC
GGAGCAAATTTTCCAGGATTTAATGGCGGTGTGCTTTCAGTGGTAGGCAACAACGAGGTGCCTATGGTGACTTCGTCAATTTCAAGGATTTGCCGGCCTA[C/G]
TCTTCGAATGTGATCATAGGGGTAGGGTTTGCGTGCATGCGTTTATAGGGGTAAGTGCGCATGCATTATGAGTATCTGCATCGTACTGTGTAATTATCAA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 36.20% | 25.30% | 3.53% | 34.91% | NA |
| All Indica | 2759 | 32.50% | 25.60% | 5.62% | 36.28% | NA |
| All Japonica | 1512 | 47.10% | 21.80% | 0.46% | 30.69% | NA |
| Aus | 269 | 19.70% | 41.30% | 1.12% | 37.92% | NA |
| Indica I | 595 | 46.10% | 30.60% | 12.61% | 10.76% | NA |
| Indica II | 465 | 24.10% | 14.00% | 3.44% | 58.49% | NA |
| Indica III | 913 | 23.40% | 29.00% | 2.41% | 45.13% | NA |
| Indica Intermediate | 786 | 37.80% | 24.70% | 5.34% | 32.19% | NA |
| Temperate Japonica | 767 | 80.70% | 15.10% | 0.39% | 3.78% | NA |
| Tropical Japonica | 504 | 4.40% | 34.30% | 0.60% | 60.71% | NA |
| Japonica Intermediate | 241 | 29.50% | 16.60% | 0.41% | 53.53% | NA |
| VI/Aromatic | 96 | 7.30% | 32.30% | 1.04% | 59.38% | NA |
| Intermediate | 90 | 48.90% | 21.10% | 1.11% | 28.89% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1217798279 | G -> C | LOC_Os12g29780.1 | upstream_gene_variant ; 3837.0bp to feature; MODIFIER | silent_mutation | Average:28.394; most accessible tissue: Zhenshan97 root, score: 56.557 | N | N | N | N |
| vg1217798279 | G -> C | LOC_Os12g29760-LOC_Os12g29780 | intergenic_region ; MODIFIER | silent_mutation | Average:28.394; most accessible tissue: Zhenshan97 root, score: 56.557 | N | N | N | N |
| vg1217798279 | G -> DEL | N | N | silent_mutation | Average:28.394; most accessible tissue: Zhenshan97 root, score: 56.557 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1217798279 | NA | 3.35E-06 | mr1164 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217798279 | NA | 8.62E-06 | mr1192 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217798279 | NA | 4.53E-06 | mr1355_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217798279 | 8.09E-06 | 1.88E-06 | mr1355_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217798279 | 4.06E-07 | 1.12E-07 | mr1360_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217798279 | 2.54E-06 | 4.61E-06 | mr1452_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217798279 | NA | 2.79E-06 | mr1662_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217798279 | NA | 4.78E-06 | mr1895_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |