\
| Variant ID: vg1217795967 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 17795967 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.54, C: 0.46, others allele: 0.00, population size: 94. )
TTTTTTAAAAATTCTCCATGATTAGTTACGCTCTTTGAAATTATATTGGAATTTTTAGAGCTTAATTGCTAATTTTATTAATATAGACATCATTTAACAA[C/T]
TATTTAATTGGAAAAAGAAAGAAAATACTTCCATTTAGGTTTGCTTCCAAATAAACACATTCAATTACTTATATATGTAAATCTTCTGAAAAAATGAGCA
TGCTCATTTTTTCAGAAGATTTACATATATAAGTAATTGAATGTGTTTATTTGGAAGCAAACCTAAATGGAAGTATTTTCTTTCTTTTTCCAATTAAATA[G/A]
TTGTTAAATGATGTCTATATTAATAAAATTAGCAATTAAGCTCTAAAAATTCCAATATAATTTCAAAGAGCGTAACTAATCATGGAGAATTTTTAAAAAA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 35.80% | 30.70% | 0.19% | 33.28% | NA |
| All Indica | 2759 | 31.70% | 34.70% | 0.25% | 33.42% | NA |
| All Japonica | 1512 | 47.30% | 22.00% | 0.00% | 30.69% | NA |
| Aus | 269 | 20.40% | 41.30% | 0.37% | 37.92% | NA |
| Indica I | 595 | 45.90% | 52.10% | 0.00% | 2.02% | NA |
| Indica II | 465 | 21.70% | 17.40% | 0.43% | 60.43% | NA |
| Indica III | 913 | 23.30% | 34.00% | 0.11% | 42.61% | NA |
| Indica Intermediate | 786 | 36.50% | 32.40% | 0.51% | 30.53% | NA |
| Temperate Japonica | 767 | 80.80% | 15.40% | 0.00% | 3.78% | NA |
| Tropical Japonica | 504 | 4.60% | 34.70% | 0.00% | 60.71% | NA |
| Japonica Intermediate | 241 | 29.90% | 16.60% | 0.00% | 53.53% | NA |
| VI/Aromatic | 96 | 5.20% | 32.30% | 1.04% | 61.46% | NA |
| Intermediate | 90 | 46.70% | 24.40% | 0.00% | 28.89% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1217795967 | C -> DEL | N | N | silent_mutation | Average:18.834; most accessible tissue: Zhenshan97 flower, score: 38.669 | N | N | N | N |
| vg1217795967 | C -> T | LOC_Os12g29760.1 | upstream_gene_variant ; 4856.0bp to feature; MODIFIER | silent_mutation | Average:18.834; most accessible tissue: Zhenshan97 flower, score: 38.669 | N | N | N | N |
| vg1217795967 | C -> T | LOC_Os12g29760.2 | upstream_gene_variant ; 4856.0bp to feature; MODIFIER | silent_mutation | Average:18.834; most accessible tissue: Zhenshan97 flower, score: 38.669 | N | N | N | N |
| vg1217795967 | C -> T | LOC_Os12g29760-LOC_Os12g29780 | intergenic_region ; MODIFIER | silent_mutation | Average:18.834; most accessible tissue: Zhenshan97 flower, score: 38.669 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1217795967 | NA | 3.35E-06 | mr1164 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217795967 | NA | 8.62E-06 | mr1192 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217795967 | NA | 9.56E-06 | mr1579 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217795967 | NA | 4.21E-06 | mr1355_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217795967 | 4.75E-06 | 8.87E-07 | mr1355_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217795967 | 3.31E-07 | 5.88E-08 | mr1360_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217795967 | 4.80E-06 | 6.96E-06 | mr1452_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |