\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1217795967:

Variant ID: vg1217795967 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 17795967
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.54, C: 0.46, others allele: 0.00, population size: 94. )

Flanking Sequence (100 bp) in Reference Genome:


TTTTTTAAAAATTCTCCATGATTAGTTACGCTCTTTGAAATTATATTGGAATTTTTAGAGCTTAATTGCTAATTTTATTAATATAGACATCATTTAACAA[C/T]
TATTTAATTGGAAAAAGAAAGAAAATACTTCCATTTAGGTTTGCTTCCAAATAAACACATTCAATTACTTATATATGTAAATCTTCTGAAAAAATGAGCA

Reverse complement sequence

TGCTCATTTTTTCAGAAGATTTACATATATAAGTAATTGAATGTGTTTATTTGGAAGCAAACCTAAATGGAAGTATTTTCTTTCTTTTTCCAATTAAATA[G/A]
TTGTTAAATGATGTCTATATTAATAAAATTAGCAATTAAGCTCTAAAAATTCCAATATAATTTCAAAGAGCGTAACTAATCATGGAGAATTTTTAAAAAA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 35.80% 30.70% 0.19% 33.28% NA
All Indica  2759 31.70% 34.70% 0.25% 33.42% NA
All Japonica  1512 47.30% 22.00% 0.00% 30.69% NA
Aus  269 20.40% 41.30% 0.37% 37.92% NA
Indica I  595 45.90% 52.10% 0.00% 2.02% NA
Indica II  465 21.70% 17.40% 0.43% 60.43% NA
Indica III  913 23.30% 34.00% 0.11% 42.61% NA
Indica Intermediate  786 36.50% 32.40% 0.51% 30.53% NA
Temperate Japonica  767 80.80% 15.40% 0.00% 3.78% NA
Tropical Japonica  504 4.60% 34.70% 0.00% 60.71% NA
Japonica Intermediate  241 29.90% 16.60% 0.00% 53.53% NA
VI/Aromatic  96 5.20% 32.30% 1.04% 61.46% NA
Intermediate  90 46.70% 24.40% 0.00% 28.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1217795967 C -> DEL N N silent_mutation Average:18.834; most accessible tissue: Zhenshan97 flower, score: 38.669 N N N N
vg1217795967 C -> T LOC_Os12g29760.1 upstream_gene_variant ; 4856.0bp to feature; MODIFIER silent_mutation Average:18.834; most accessible tissue: Zhenshan97 flower, score: 38.669 N N N N
vg1217795967 C -> T LOC_Os12g29760.2 upstream_gene_variant ; 4856.0bp to feature; MODIFIER silent_mutation Average:18.834; most accessible tissue: Zhenshan97 flower, score: 38.669 N N N N
vg1217795967 C -> T LOC_Os12g29760-LOC_Os12g29780 intergenic_region ; MODIFIER silent_mutation Average:18.834; most accessible tissue: Zhenshan97 flower, score: 38.669 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1217795967 NA 3.35E-06 mr1164 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217795967 NA 8.62E-06 mr1192 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217795967 NA 9.56E-06 mr1579 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217795967 NA 4.21E-06 mr1355_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217795967 4.75E-06 8.87E-07 mr1355_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217795967 3.31E-07 5.88E-08 mr1360_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217795967 4.80E-06 6.96E-06 mr1452_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251