\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1217787647:

Variant ID: vg1217787647 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 17787647
Reference Allele: TAlternative Allele: A
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ACCATTATTACCACTGTCCAATAACCAACACACAAATTTCGCTCAAACTCATTCATCCACTGCACACATGTACAGCGAGCACTGCAACTCTAAAGGTCAG[T/A]
TAATTTAATAGACTAAAAGATCGATCGAGCATTTAGTCTGATGATATTTCGTGTTGATTTTGGAATTTGATGATGATCGTTTGCATTCTCGAGCATAAGG

Reverse complement sequence

CCTTATGCTCGAGAATGCAAACGATCATCATCAAATTCCAAAATCAACACGAAATATCATCAGACTAAATGCTCGATCGATCTTTTAGTCTATTAAATTA[A/T]
CTGACCTTTAGAGTTGCAGTGCTCGCTGTACATGTGTGCAGTGGATGAATGAGTTTGAGCGAAATTTGTGTGTTGGTTATTGGACAGTGGTAATAATGGT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 77.70% 21.80% 0.06% 0.38% NA
All Indica  2759 67.00% 32.30% 0.11% 0.54% NA
All Japonica  1512 91.50% 8.30% 0.00% 0.20% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 97.60% 2.40% 0.00% 0.00% NA
Indica II  465 35.90% 62.20% 0.00% 1.94% NA
Indica III  913 61.20% 38.30% 0.22% 0.22% NA
Indica Intermediate  786 69.00% 30.40% 0.13% 0.51% NA
Temperate Japonica  767 99.20% 0.80% 0.00% 0.00% NA
Tropical Japonica  504 78.20% 21.20% 0.00% 0.60% NA
Japonica Intermediate  241 95.00% 5.00% 0.00% 0.00% NA
VI/Aromatic  96 94.80% 5.20% 0.00% 0.00% NA
Intermediate  90 88.90% 11.10% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1217787647 T -> DEL N N silent_mutation Average:76.765; most accessible tissue: Zhenshan97 flag leaf, score: 89.423 N N N N
vg1217787647 T -> A LOC_Os12g29740.1 upstream_gene_variant ; 4949.0bp to feature; MODIFIER silent_mutation Average:76.765; most accessible tissue: Zhenshan97 flag leaf, score: 89.423 N N N N
vg1217787647 T -> A LOC_Os12g29760.1 downstream_gene_variant ; 1025.0bp to feature; MODIFIER silent_mutation Average:76.765; most accessible tissue: Zhenshan97 flag leaf, score: 89.423 N N N N
vg1217787647 T -> A LOC_Os12g29760.2 downstream_gene_variant ; 1025.0bp to feature; MODIFIER silent_mutation Average:76.765; most accessible tissue: Zhenshan97 flag leaf, score: 89.423 N N N N
vg1217787647 T -> A LOC_Os12g29750.1 intron_variant ; MODIFIER silent_mutation Average:76.765; most accessible tissue: Zhenshan97 flag leaf, score: 89.423 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1217787647 T A 0.02 0.02 0.02 0.01 0.01 0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1217787647 2.66E-06 5.03E-08 mr1024 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217787647 NA 2.01E-08 mr1174 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217787647 NA 2.26E-06 mr1232 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217787647 NA 3.89E-07 mr1364 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217787647 NA 1.70E-07 mr1443 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217787647 NA 1.48E-08 mr1557 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217787647 NA 2.80E-10 mr1565 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217787647 NA 1.57E-08 mr1565 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217787647 NA 4.15E-10 mr1794 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217787647 NA 1.69E-08 mr1024_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217787647 NA 7.94E-08 mr1347_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217787647 NA 2.14E-06 mr1498_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217787647 NA 3.68E-10 mr1557_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217787647 NA 4.53E-11 mr1565_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217787647 NA 5.67E-10 mr1565_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217787647 NA 5.89E-08 mr1659_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251