Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1217716094:

Variant ID: vg1217716094 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 17716094
Reference Allele: A	Alternative Allele: T
Primary Allele: A	Secondary Allele: T

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.92, T: 0.06, others allele: 0.00, population size: 80. )

Flanking Sequence (100 bp) in Reference Genome:

CCTACGCCACCCCGTGTGAGAGAGAGAGAGAGAGTGAGTGAGTGAAGAGAGAGAGGAAGAGAGGAAGGGGAGGTATGACAGGTGGGTCCCATAATTTTTT[A/T]
AAAAAAGAAAATGCTGACTGGATTGTCACGCGTAAGCCACGTAGGACAAAACTGCTCTGGATTGGGTCGAGGGGGGTAATTCGTTCAGTATTGAAAGTTC

Reverse complement sequence

GAACTTTCAATACTGAACGAATTACCCCCCTCGACCCAATCCAGAGCAGTTTTGTCCTACGTGGCTTACGCGTGACAATCCAGTCAGCATTTTCTTTTTT[T/A]
AAAAAATTATGGGACCCACCTGTCATACCTCCCCTTCCTCTCTTCCTCTCTCTCTTCACTCACTCACTCTCTCTCTCTCTCTCACACGGGGTGGCGTAGG

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	51.40%	20.10%	9.48%	18.98%	NA
All Indica	2759	43.80%	23.60%	13.12%	19.46%	NA
All Japonica	1512	66.70%	13.30%	0.60%	19.38%	NA
Aus	269	55.80%	14.50%	21.56%	8.18%	NA
Indica I	595	50.60%	38.30%	1.34%	9.75%	NA
Indica II	465	31.80%	21.70%	14.41%	32.04%	NA
Indica III	913	40.20%	20.60%	21.80%	17.42%	NA
Indica Intermediate	786	50.00%	17.00%	11.20%	21.76%	NA
Temperate Japonica	767	84.10%	2.50%	0.39%	13.04%	NA
Tropical Japonica	504	39.10%	28.00%	0.60%	32.34%	NA
Japonica Intermediate	241	69.30%	17.00%	1.24%	12.45%	NA
VI/Aromatic	96	8.30%	50.00%	11.46%	30.21%	NA
Intermediate	90	60.00%	13.30%	8.89%	17.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1217716094	A -> DEL	N	N	silent_mutation	Average:28.712; most accessible tissue: Minghui63 panicle, score: 42.799	N	N	N	N
vg1217716094	A -> T	LOC_Os12g29690.1	upstream_gene_variant ; 3580.0bp to feature; MODIFIER	silent_mutation	Average:28.712; most accessible tissue: Minghui63 panicle, score: 42.799	N	N	N	N
vg1217716094	A -> T	LOC_Os12g29700.1	upstream_gene_variant ; 1412.0bp to feature; MODIFIER	silent_mutation	Average:28.712; most accessible tissue: Minghui63 panicle, score: 42.799	N	N	N	N
vg1217716094	A -> T	LOC_Os12g29690-LOC_Os12g29700	intergenic_region ; MODIFIER	silent_mutation	Average:28.712; most accessible tissue: Minghui63 panicle, score: 42.799	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1217716094	2.60E-06	5.71E-06	mr1380	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217716094	6.64E-06	7.44E-06	mr1561	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217716094	NA	5.70E-07	mr1627	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217716094	NA	3.73E-07	mr1024_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217716094	NA	1.79E-06	mr1194_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217716094	NA	2.19E-07	mr1215_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217716094	NA	9.85E-06	mr1215_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217716094	NA	7.96E-07	mr1220_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217716094	NA	1.89E-06	mr1705_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217716094	NA	3.65E-06	mr1844_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217716094	NA	7.17E-06	mr1854_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251