\
| Variant ID: vg1217716094 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 17716094 |
| Reference Allele: A | Alternative Allele: T |
| Primary Allele: A | Secondary Allele: T |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.92, T: 0.06, others allele: 0.00, population size: 80. )
CCTACGCCACCCCGTGTGAGAGAGAGAGAGAGAGTGAGTGAGTGAAGAGAGAGAGGAAGAGAGGAAGGGGAGGTATGACAGGTGGGTCCCATAATTTTTT[A/T]
AAAAAAGAAAATGCTGACTGGATTGTCACGCGTAAGCCACGTAGGACAAAACTGCTCTGGATTGGGTCGAGGGGGGTAATTCGTTCAGTATTGAAAGTTC
GAACTTTCAATACTGAACGAATTACCCCCCTCGACCCAATCCAGAGCAGTTTTGTCCTACGTGGCTTACGCGTGACAATCCAGTCAGCATTTTCTTTTTT[T/A]
AAAAAATTATGGGACCCACCTGTCATACCTCCCCTTCCTCTCTTCCTCTCTCTCTTCACTCACTCACTCTCTCTCTCTCTCTCACACGGGGTGGCGTAGG
| Populations | Population Size | Frequency of A(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 51.40% | 20.10% | 9.48% | 18.98% | NA |
| All Indica | 2759 | 43.80% | 23.60% | 13.12% | 19.46% | NA |
| All Japonica | 1512 | 66.70% | 13.30% | 0.60% | 19.38% | NA |
| Aus | 269 | 55.80% | 14.50% | 21.56% | 8.18% | NA |
| Indica I | 595 | 50.60% | 38.30% | 1.34% | 9.75% | NA |
| Indica II | 465 | 31.80% | 21.70% | 14.41% | 32.04% | NA |
| Indica III | 913 | 40.20% | 20.60% | 21.80% | 17.42% | NA |
| Indica Intermediate | 786 | 50.00% | 17.00% | 11.20% | 21.76% | NA |
| Temperate Japonica | 767 | 84.10% | 2.50% | 0.39% | 13.04% | NA |
| Tropical Japonica | 504 | 39.10% | 28.00% | 0.60% | 32.34% | NA |
| Japonica Intermediate | 241 | 69.30% | 17.00% | 1.24% | 12.45% | NA |
| VI/Aromatic | 96 | 8.30% | 50.00% | 11.46% | 30.21% | NA |
| Intermediate | 90 | 60.00% | 13.30% | 8.89% | 17.78% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1217716094 | A -> DEL | N | N | silent_mutation | Average:28.712; most accessible tissue: Minghui63 panicle, score: 42.799 | N | N | N | N |
| vg1217716094 | A -> T | LOC_Os12g29690.1 | upstream_gene_variant ; 3580.0bp to feature; MODIFIER | silent_mutation | Average:28.712; most accessible tissue: Minghui63 panicle, score: 42.799 | N | N | N | N |
| vg1217716094 | A -> T | LOC_Os12g29700.1 | upstream_gene_variant ; 1412.0bp to feature; MODIFIER | silent_mutation | Average:28.712; most accessible tissue: Minghui63 panicle, score: 42.799 | N | N | N | N |
| vg1217716094 | A -> T | LOC_Os12g29690-LOC_Os12g29700 | intergenic_region ; MODIFIER | silent_mutation | Average:28.712; most accessible tissue: Minghui63 panicle, score: 42.799 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1217716094 | 2.60E-06 | 5.71E-06 | mr1380 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217716094 | 6.64E-06 | 7.44E-06 | mr1561 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217716094 | NA | 5.70E-07 | mr1627 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217716094 | NA | 3.73E-07 | mr1024_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217716094 | NA | 1.79E-06 | mr1194_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217716094 | NA | 2.19E-07 | mr1215_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217716094 | NA | 9.85E-06 | mr1215_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217716094 | NA | 7.96E-07 | mr1220_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217716094 | NA | 1.89E-06 | mr1705_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217716094 | NA | 3.65E-06 | mr1844_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217716094 | NA | 7.17E-06 | mr1854_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |