Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1217711180:

Variant ID: vg1217711180 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 17711180
Reference Allele: C	Alternative Allele: T,A
Primary Allele: C	Secondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.93, A: 0.08, others allele: 0.00, population size: 236. )

Flanking Sequence (100 bp) in Reference Genome:

ATTCTTTACTTTCATATACTCTAGTCCATCGGTCCAAAGTAAGTTTATTCCTTAATAACCGACCTACGGTTTTTATAGCAAGAGGGAAACCCTTCAATCT[C/T,A]
TTCACTATGTCTACCCCAACTTTCTGTAAACCCGATGGATAATCTTCCCATGTCTTGTTGTTATCAAACACACATGCCTGGAATAACCGCATAGAATCTT

Reverse complement sequence

AAGATTCTATGCGGTTATTCCAGGCATGTGTGTTTGATAACAACAAGACATGGGAAGATTATCCATCGGGTTTACAGAAAGTTGGGGTAGACATAGTGAA[G/A,T]
AGATTGAAGGGTTTCCCTCTTGCTATAAAAACCGTAGGTCGGTTATTAAGGAATAAACTTACTTTGGACCGATGGACTAGAGTATATGAAAGTAAAGAAT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	55.00%	25.10%	5.01%	6.62%	T: 8.27%
All Indica	2759	49.40%	21.60%	7.90%	7.03%	T: 13.99%
All Japonica	1512	67.80%	24.50%	0.60%	6.88%	T: 0.26%
Aus	269	43.10%	49.80%	2.60%	4.46%	NA
Indica I	595	48.20%	32.10%	4.87%	7.23%	T: 7.56%
Indica II	465	40.90%	11.40%	9.25%	9.46%	T: 29.03%
Indica III	913	59.10%	16.60%	8.11%	6.35%	T: 9.75%
Indica Intermediate	786	44.10%	25.60%	9.16%	6.23%	T: 14.89%
Temperate Japonica	767	94.50%	4.60%	0.26%	0.26%	T: 0.39%
Tropical Japonica	504	38.10%	42.10%	1.39%	18.45%	NA
Japonica Intermediate	241	44.80%	51.00%	0.00%	3.73%	T: 0.41%
VI/Aromatic	96	36.50%	58.30%	1.04%	3.12%	T: 1.04%
Intermediate	90	67.80%	30.00%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1217711180	C -> DEL	LOC_Os12g29690.1	N	frameshift_variant	Average:44.354; most accessible tissue: Zhenshan97 flower, score: 66.841	N	N	N	N
vg1217711180	C -> A	LOC_Os12g29690.1	missense_variant ; p.Lys445Asn; MODERATE	nonsynonymous_codon ; K445N	Average:44.354; most accessible tissue: Zhenshan97 flower, score: 66.841	benign	0.293	TOLERATED	0.16
vg1217711180	C -> T	LOC_Os12g29690.1	synonymous_variant ; p.Lys445Lys; LOW	synonymous_codon	Average:44.354; most accessible tissue: Zhenshan97 flower, score: 66.841	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1217711180	NA	6.18E-06	mr1020	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217711180	NA	3.86E-06	mr1063	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217711180	NA	4.15E-06	mr1177	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217711180	NA	1.59E-08	mr1180	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217711180	NA	1.03E-07	mr1183	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217711180	NA	1.37E-06	mr1327	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217711180	NA	8.14E-08	mr1503	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217711180	NA	9.97E-06	mr1561	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217711180	NA	5.34E-09	mr1627	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217711180	NA	1.67E-06	mr1653	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217711180	NA	2.40E-06	mr1977	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217711180	NA	6.18E-06	mr1977	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217711180	NA	6.75E-07	mr1041_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217711180	NA	6.48E-07	mr1063_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217711180	NA	5.43E-08	mr1180_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217711180	NA	2.92E-09	mr1183_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217711180	NA	7.13E-06	mr1206_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217711180	NA	1.93E-06	mr1220_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217711180	NA	2.59E-08	mr1252_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217711180	NA	2.34E-09	mr1263_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217711180	NA	1.52E-06	mr1293_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217711180	NA	7.59E-07	mr1294_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217711180	NA	3.62E-06	mr1302_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217711180	NA	6.33E-06	mr1419_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217711180	NA	5.45E-06	mr1420_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217711180	NA	7.89E-08	mr1494_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217711180	NA	1.41E-08	mr1528_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217711180	NA	9.40E-06	mr1609_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217711180	NA	1.66E-07	mr1653_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217711180	NA	1.64E-08	mr1729_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217711180	NA	4.59E-07	mr1740_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217711180	NA	5.42E-09	mr1813_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217711180	NA	4.31E-06	mr1813_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217711180	NA	5.82E-08	mr1814_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217711180	NA	1.35E-06	mr1823_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217711180	NA	6.25E-07	mr1824_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217711180	NA	4.42E-06	mr1824_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217711180	NA	4.30E-06	mr1831_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217711180	NA	2.76E-06	mr1838_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217711180	NA	6.74E-06	mr1844_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217711180	NA	1.25E-07	mr1854_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217711180	NA	3.49E-06	mr1854_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217711180	NA	9.24E-07	mr1856_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217711180	NA	1.09E-06	mr1876_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217711180	NA	6.44E-09	mr1894_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251