Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1217709247:

Variant ID: vg1217709247 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 17709247
Reference Allele: AAlternative Allele: T
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.84, T: 0.16, others allele: 0.00, population size: 61. )

Flanking Sequence (100 bp) in Reference Genome:


GGAAAATGAGAGAGCACCTGTGTCAATTCCCTCCCACTAGCACCATATGAATTGATCTCGAGATTCTCAACTAAAAGATTATACTTAACTTCGTTTTCAC[A/T]
ATCAACTGGCAACAATATGCTACCTGAATCAGTTATCTGAAGGGTCTTGAGACATGTCAGCATTTTAAGGTGATCCAACGATATAGGAGGACACTTTTGT

Reverse complement sequence

ACAAAAGTGTCCTCCTATATCGTTGGATCACCTTAAAATGCTGACATGTCTCAAGACCCTTCAGATAACTGATTCAGGTAGCATATTGTTGCCAGTTGAT[T/A]
GTGAAAACGAAGTTAAGTATAATCTTTTAGTTGAGAATCTCGAGATCAATTCATATGGTGCTAGTGGGAGGGAATTGACACAGGTGCTCTCTCATTTTCC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 44.50% 34.20% 13.86% 7.45% NA
All Indica  2759 34.20% 35.70% 19.17% 10.91% NA
All Japonica  1512 60.10% 31.40% 6.02% 2.51% NA
Aus  269 55.80% 35.30% 4.46% 4.46% NA
Indica I  595 23.90% 49.90% 22.18% 4.03% NA
Indica II  465 21.90% 26.00% 24.52% 27.53% NA
Indica III  913 48.00% 32.90% 13.47% 5.70% NA
Indica Intermediate  786 33.30% 34.00% 20.36% 12.34% NA
Temperate Japonica  767 78.50% 19.40% 1.96% 0.13% NA
Tropical Japonica  504 32.30% 55.20% 7.94% 4.56% NA
Japonica Intermediate  241 59.30% 19.90% 14.94% 5.81% NA
VI/Aromatic  96 53.10% 35.40% 11.46% 0.00% NA
Intermediate  90 53.30% 32.20% 13.33% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1217709247 A -> DEL LOC_Os12g29690.1 N frameshift_variant Average:61.278; most accessible tissue: Zhenshan97 flower, score: 95.05 N N N N
vg1217709247 A -> T LOC_Os12g29690.1 missense_variant ; p.Cys1090Ser; MODERATE nonsynonymous_codon ; C1090S Average:61.278; most accessible tissue: Zhenshan97 flower, score: 95.05 benign -0.244 TOLERATED 0.88

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1217709247 A T 0.03 0.01 0.0 -0.01 -0.01 -0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1217709247 NA 3.68E-06 mr1002 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217709247 NA 7.63E-06 mr1188 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217709247 4.74E-07 4.03E-08 mr1327 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217709247 NA 2.06E-06 mr1558 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251