\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1217708909:

Variant ID: vg1217708909 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 17708909
Reference Allele: CAlternative Allele: G,T
Primary Allele: CSecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AGGAAGAGGAGCAGAGGAGCTTGGGGCAATCATATATCCCCAACGTTTGGAGGGAGAGCAGACCTTGGATTCCACCGCTGTCGAGGCTTAGCTCTCTGCA[C/G,T]
TCACTGATTTCAAACACCTTTATTTGGGGAGGCAGGAGAAGTAGTCCATCGTCTGCTGTTGCTGTTTCCATCTCCTCCGCTTCTCCTGTCTGCTGCTGCA

Reverse complement sequence

TGCAGCAGCAGACAGGAGAAGCGGAGGAGATGGAAACAGCAACAGCAGACGATGGACTACTTCTCCTGCCTCCCCAAATAAAGGTGTTTGAAATCAGTGA[G/C,A]
TGCAGAGAGCTAAGCCTCGACAGCGGTGGAATCCAAGGTCTGCTCTCCCTCCAAACGTTGGGGATATATGATTGCCCCAAGCTCCTCTGCTCCTCTTCCT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 69.80% 10.40% 6.58% 9.59% T: 3.60%
All Indica  2759 66.80% 3.90% 9.60% 15.80% T: 3.84%
All Japonica  1512 77.10% 21.00% 1.46% 0.33% T: 0.07%
Aus  269 60.60% 8.20% 6.32% 2.23% T: 22.68%
Indica I  595 42.90% 9.60% 24.37% 20.00% T: 3.19%
Indica II  465 75.70% 0.20% 4.73% 15.91% T: 3.44%
Indica III  913 76.00% 1.10% 4.05% 13.69% T: 5.15%
Indica Intermediate  786 69.10% 5.10% 7.76% 15.01% T: 3.05%
Temperate Japonica  767 81.50% 15.90% 2.22% 0.26% T: 0.13%
Tropical Japonica  504 66.70% 32.50% 0.60% 0.20% NA
Japonica Intermediate  241 85.10% 13.30% 0.83% 0.83% NA
VI/Aromatic  96 68.80% 28.10% 0.00% 3.12% NA
Intermediate  90 67.80% 18.90% 7.78% 3.33% T: 2.22%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1217708909 C -> DEL LOC_Os12g29690.1 N frameshift_variant Average:64.373; most accessible tissue: Zhenshan97 flower, score: 98.218 N N N N
vg1217708909 C -> G LOC_Os12g29690.1 missense_variant ; p.Glu1202Asp; MODERATE frameshift_variant Average:64.373; most accessible tissue: Zhenshan97 flower, score: 98.218 N N N N
vg1217708909 C -> G LOC_Os12g29690.1 missense_variant ; p.Glu1202Asp; MODERATE nonsynonymous_codon ; E1202N Average:64.373; most accessible tissue: Zhenshan97 flower, score: 98.218 possibly damaging 1.681 TOLERATED 0.55
vg1217708909 C -> G LOC_Os12g29690.1 missense_variant ; p.Glu1202Asp; MODERATE nonsynonymous_codon ; E1202G Average:64.373; most accessible tissue: Zhenshan97 flower, score: 98.218 possibly damaging 1.591 TOLERATED 0.48
vg1217708909 C -> G LOC_Os12g29690.1 missense_variant ; p.Glu1202Asp; MODERATE nonsynonymous_codon ; E1202V Average:64.373; most accessible tissue: Zhenshan97 flower, score: 98.218 possibly damaging 1.762 TOLERATED 0.35
vg1217708909 C -> G LOC_Os12g29690.1 missense_variant ; p.Glu1202Asp; MODERATE nonsynonymous_codon ; E1202D Average:64.373; most accessible tissue: Zhenshan97 flower, score: 98.218 benign 1.245 TOLERATED 0.62
vg1217708909 C -> T LOC_Os12g29690.1 synonymous_variant ; p.Glu1202Glu; LOW nonsynonymous_codon ; E1202G Average:64.373; most accessible tissue: Zhenshan97 flower, score: 98.218 possibly damaging 1.591 TOLERATED 0.48
vg1217708909 C -> T LOC_Os12g29690.1 synonymous_variant ; p.Glu1202Glu; LOW nonsynonymous_codon ; E1202V Average:64.373; most accessible tissue: Zhenshan97 flower, score: 98.218 possibly damaging 1.762 TOLERATED 0.35
vg1217708909 C -> T LOC_Os12g29690.1 synonymous_variant ; p.Glu1202Glu; LOW synonymous_codon Average:64.373; most accessible tissue: Zhenshan97 flower, score: 98.218 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1217708909 C G -0.07 -0.03 0.0 -0.04 -0.05 -0.06
vg1217708909 C T -0.08 -0.06 -0.03 -0.05 -0.05 -0.05

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1217708909 NA 8.28E-07 mr1308 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217708909 NA 2.21E-06 mr1389 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217708909 NA 1.74E-06 mr1864 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217708909 NA 1.75E-07 mr1215_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217708909 NA 9.49E-06 mr1220_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217708909 7.48E-07 NA mr1308_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217708909 4.13E-07 2.88E-08 mr1308_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217708909 NA 7.47E-07 mr1361_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217708909 NA 8.32E-08 mr1583_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217708909 NA 8.45E-07 mr1849_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251