\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1217707522:

Variant ID: vg1217707522 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 17707522
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GGGAGGTTTCCAAGCGAGCTGATGGCAAGACATCCATAGATCCCTAATGTCTTGATGTTGGGGATTTCACTAAGCCCAGTAGGGAGGGACTGCAGTTTTT[T/C]
GCACCTCGAAAATTCTAGGTCCTCAATGGAGGTGAGAATGTGAAGGGCCTTCTCTCATAACTTATTATGAGAGATTATAATAAGTTATGTTATTTATTCA

Reverse complement sequence

TGAATAAATAACATAACTTATTATAATCTCTCATAATAAGTTATGAGAGAAGGCCCTTCACATTCTCACCTCCATTGAGGACCTAGAATTTTCGAGGTGC[A/G]
AAAAACTGCAGTCCCTCCCTACTGGGCTTAGTGAAATCCCCAACATCAAGACATTAGGGATCTATGGATGTCTTGCCATCAGCTCGCTTGGAAACCTCCC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 21.40% 7.50% 14.49% 56.60% NA
All Indica  2759 8.30% 11.90% 20.44% 59.30% NA
All Japonica  1512 44.70% 1.10% 4.56% 49.60% NA
Aus  269 25.70% 3.00% 11.90% 59.48% NA
Indica I  595 8.60% 16.00% 24.03% 51.43% NA
Indica II  465 8.80% 12.30% 22.37% 56.56% NA
Indica III  913 5.90% 11.70% 17.63% 64.73% NA
Indica Intermediate  786 10.70% 8.90% 19.85% 60.56% NA
Temperate Japonica  767 76.50% 0.70% 2.22% 20.60% NA
Tropical Japonica  504 3.60% 2.20% 7.74% 86.51% NA
Japonica Intermediate  241 29.50% 0.40% 5.39% 64.73% NA
VI/Aromatic  96 7.30% 1.00% 8.33% 83.33% NA
Intermediate  90 31.10% 1.10% 13.33% 54.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1217707522 T -> C LOC_Os12g29680.1 upstream_gene_variant ; 1404.0bp to feature; MODIFIER silent_mutation Average:23.738; most accessible tissue: Zhenshan97 flower, score: 69.089 N N N N
vg1217707522 T -> C LOC_Os12g29690.1 downstream_gene_variant ; 478.0bp to feature; MODIFIER silent_mutation Average:23.738; most accessible tissue: Zhenshan97 flower, score: 69.089 N N N N
vg1217707522 T -> C LOC_Os12g29680-LOC_Os12g29690 intergenic_region ; MODIFIER silent_mutation Average:23.738; most accessible tissue: Zhenshan97 flower, score: 69.089 N N N N
vg1217707522 T -> DEL N N silent_mutation Average:23.738; most accessible tissue: Zhenshan97 flower, score: 69.089 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1217707522 NA 3.75E-06 mr1042 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217707522 NA 9.41E-06 mr1043 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217707522 NA 7.52E-07 mr1399 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217707522 NA 2.01E-06 mr1627 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217707522 NA 4.69E-06 mr1024_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217707522 NA 9.23E-06 mr1045_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217707522 2.04E-06 2.33E-08 mr1194_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217707522 NA 3.36E-10 mr1198_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217707522 NA 4.02E-06 mr1198_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217707522 NA 3.43E-06 mr1204_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217707522 NA 3.40E-07 mr1205_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217707522 NA 1.24E-07 mr1215_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217707522 NA 7.43E-07 mr1215_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217707522 NA 7.93E-09 mr1220_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217707522 NA 2.10E-07 mr1220_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217707522 NA 8.51E-09 mr1221_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217707522 NA 1.37E-06 mr1227_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217707522 NA 1.42E-06 mr1230_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217707522 NA 7.12E-06 mr1252_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217707522 NA 6.62E-08 mr1302_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217707522 NA 7.23E-06 mr1302_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217707522 NA 4.33E-08 mr1376_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217707522 NA 2.42E-06 mr1407_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217707522 NA 6.02E-08 mr1431_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217707522 NA 7.06E-06 mr1500_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217707522 NA 4.29E-06 mr1554_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217707522 NA 2.18E-06 mr1562_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217707522 NA 3.40E-06 mr1605_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217707522 NA 6.88E-06 mr1611_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217707522 NA 3.20E-07 mr1705_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217707522 NA 8.48E-06 mr1711_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217707522 NA 2.90E-06 mr1735_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217707522 NA 1.92E-07 mr1844_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217707522 NA 2.06E-06 mr1854_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217707522 NA 8.86E-07 mr1869_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217707522 5.47E-06 5.47E-06 mr1869_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217707522 2.16E-06 2.16E-06 mr1905_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251