Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1217706014:

Variant ID: vg1217706014 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 17706014
Reference Allele: TAlternative Allele: C,A
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, A: 0.01, others allele: 0.00, population size: 177. )

Flanking Sequence (100 bp) in Reference Genome:


GACGGATCCATTTGATCCTAAAATCTTGAAAATAACTTAGCCAATGCTTAAAACCTTGGACTATTGCGCCATACATCGATCTGTTAACTTCCACATCAGC[T/C,A]
ACCATCTTCTGAACTTCCAGACTATCGGTCTCAAGGATTACCTTTGAAACACCCAATTCACTCGCTAGCTGCACTGCCTGAAGACACACCAACGCTTCTG

Reverse complement sequence

CAGAAGCGTTGGTGTGTCTTCAGGCAGTGCAGCTAGCGAGTGAATTGGGTGTTTCAAAGGTAATCCTTGAGACCGATAGTCTGGAAGTTCAGAAGATGGT[A/G,T]
GCTGATGTGGAAGTTAACAGATCGATGTATGGCGCAATAGTCCAAGGTTTTAAGCATTGGCTAAGTTATTTTCAAGATTTTAGGATCAAATGGATCCGTC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 42.40% 20.80% 0.66% 35.61% A: 0.44%
All Indica  2759 62.20% 5.00% 0.72% 31.35% A: 0.76%
All Japonica  1512 11.00% 43.80% 0.46% 44.64% NA
Aus  269 34.60% 49.10% 0.00% 16.36% NA
Indica I  595 42.50% 7.10% 1.01% 49.41% NA
Indica II  465 80.00% 5.60% 0.43% 12.47% A: 1.51%
Indica III  913 72.40% 1.40% 0.22% 25.41% A: 0.55%
Indica Intermediate  786 54.60% 7.30% 1.27% 35.75% A: 1.15%
Temperate Japonica  767 3.90% 75.90% 0.26% 19.95% NA
Tropical Japonica  504 23.00% 3.00% 0.79% 73.21% NA
Japonica Intermediate  241 8.70% 27.40% 0.41% 63.49% NA
VI/Aromatic  96 10.40% 21.90% 3.12% 64.58% NA
Intermediate  90 23.30% 34.40% 1.11% 41.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1217706014 T -> C LOC_Os12g29690.1 downstream_gene_variant ; 1986.0bp to feature; MODIFIER silent_mutation Average:65.58; most accessible tissue: Zhenshan97 panicle, score: 76.605 N N N N
vg1217706014 T -> C LOC_Os12g29680.1 intron_variant ; MODIFIER silent_mutation Average:65.58; most accessible tissue: Zhenshan97 panicle, score: 76.605 N N N N
vg1217706014 T -> DEL N N silent_mutation Average:65.58; most accessible tissue: Zhenshan97 panicle, score: 76.605 N N N N
vg1217706014 T -> A LOC_Os12g29690.1 downstream_gene_variant ; 1986.0bp to feature; MODIFIER silent_mutation Average:65.58; most accessible tissue: Zhenshan97 panicle, score: 76.605 N N N N
vg1217706014 T -> A LOC_Os12g29680.1 intron_variant ; MODIFIER silent_mutation Average:65.58; most accessible tissue: Zhenshan97 panicle, score: 76.605 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1217706014 NA 2.61E-07 mr1002 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217706014 NA 8.75E-06 mr1180 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217706014 NA 2.05E-07 mr1183 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217706014 6.35E-06 2.28E-07 mr1327 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217706014 NA 9.11E-07 mr1503 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217706014 NA 7.25E-06 mr1561 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217706014 NA 1.25E-07 mr1617 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217706014 NA 7.95E-08 mr1627 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217706014 NA 7.70E-06 mr1708 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217706014 NA 1.46E-06 mr1805 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217706014 NA 8.94E-06 mr1839 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217706014 NA 2.81E-06 mr1977 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217706014 NA 4.14E-06 mr1194_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217706014 NA 1.75E-09 mr1805_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251