Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1217682087:

Variant ID: vg1217682087 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 17682087
Reference Allele: G	Alternative Allele: C
Primary Allele: G	Secondary Allele: C

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.79, C: 0.21, others allele: 0.00, population size: 89. )

Flanking Sequence (100 bp) in Reference Genome:

CTGGTACTAGGATAATTAATTAATACTAGCTTAATTAATTAGTCGCTGTTACCTGTTGTATGCCGCTCTCGACGGCGACGAGCTTGTCGAGGACGAGGAG[G/C]
GGCAGCTGGTTCTCGATCATGATCATGTCGCGGCGGATGTAGGGCACGGTGTAGAGCAGCCCGTGGGCGCTGAACACCGGGTCGTCGTCGGCGTAGTCGC

Reverse complement sequence

GCGACTACGCCGACGACGACCCGGTGTTCAGCGCCCACGGGCTGCTCTACACCGTGCCCTACATCCGCCGCGACATGATCATGATCGAGAACCAGCTGCC[C/G]
CTCCTCGTCCTCGACAAGCTCGTCGCCGTCGAGAGCGGCATACAACAGGTAACAGCGACTAATTAATTAAGCTAGTATTAATTAATTATCCTAGTACCAG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	72.00%	27.60%	0.32%	0.00%	NA
All Indica	2759	72.40%	27.30%	0.25%	0.00%	NA
All Japonica	1512	72.20%	27.40%	0.40%	0.00%	NA
Aus	269	64.30%	35.70%	0.00%	0.00%	NA
Indica I	595	57.80%	41.80%	0.34%	0.00%	NA
Indica II	465	84.10%	15.70%	0.22%	0.00%	NA
Indica III	913	71.40%	28.60%	0.00%	0.00%	NA
Indica Intermediate	786	77.70%	21.80%	0.51%	0.00%	NA
Temperate Japonica	767	97.10%	2.30%	0.52%	0.00%	NA
Tropical Japonica	504	42.70%	57.10%	0.20%	0.00%	NA
Japonica Intermediate	241	54.80%	44.80%	0.41%	0.00%	NA
VI/Aromatic	96	77.10%	22.90%	0.00%	0.00%	NA
Intermediate	90	75.60%	22.20%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1217682087	G -> C	LOC_Os12g29650.1	synonymous_variant ; p.Pro196Pro; LOW	synonymous_codon	Average:81.462; most accessible tissue: Minghui63 root, score: 91.993	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1217682087	3.27E-06	NA	mr1017	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217682087	6.99E-06	NA	mr1055	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217682087	2.89E-06	2.89E-06	mr1275	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217682087	NA	2.07E-07	mr1304	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217682087	NA	1.96E-07	mr1414	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217682087	3.64E-06	3.64E-06	mr1564	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217682087	NA	1.40E-06	mr1602	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217682087	2.59E-06	2.59E-06	mr1659	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217682087	NA	1.15E-08	mr1696	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217682087	NA	2.70E-06	mr1830	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217682087	NA	9.97E-06	mr1866	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217682087	NA	2.72E-06	mr1884	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217682087	NA	6.08E-06	mr1892	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217682087	NA	8.41E-08	mr1047_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217682087	NA	4.66E-08	mr1093_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217682087	NA	5.31E-07	mr1227_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217682087	NA	1.35E-09	mr1235_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217682087	NA	2.48E-06	mr1243_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217682087	NA	9.53E-07	mr1251_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217682087	NA	2.19E-07	mr1423_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217682087	NA	8.16E-07	mr1435_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217682087	NA	8.82E-08	mr1583_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217682087	NA	1.88E-08	mr1599_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217682087	NA	7.07E-06	mr1815_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217682087	NA	1.50E-06	mr1849_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251