Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1217659093:

Variant ID: vg1217659093 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 17659093
Reference Allele: C	Alternative Allele: G
Primary Allele: C	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GAGCCGCTCACAATGCAATTATCTAGACCCGAGTCGACAACACCAACGTCTTCGTCACGCCTCAACAGAACGCGGTCACGGCAATTACCCTGTTCGACAC[C/G]
ATCATCGACAAGGCTCCAACCAATGTGACACCAATCATGAATAAAGTCAAGGCCATGATCGCCACCACTGTGCCCATGGATGCTGGAGGCAGCCGTTGGC

Reverse complement sequence

GCCAACGGCTGCCTCCAGCATCCATGGGCACAGTGGTGGCGATCATGGCCTTGACTTTATTCATGATTGGTGTCACATTGGTTGGAGCCTTGTCGATGAT[G/C]
GTGTCGAACAGGGTAATTGCCGTGACCGCGTTCTGTTGAGGCGTGACGAAGACGTTGGTGTTGTCGACTCGGGTCTAGATAATTGCATTGTGAGCGGCTC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	42.20%	9.80%	1.18%	46.85%	NA
All Indica	2759	22.70%	16.50%	1.59%	59.19%	NA
All Japonica	1512	72.90%	0.30%	0.60%	26.26%	NA
Aus	269	49.80%	0.00%	0.74%	49.44%	NA
Indica I	595	19.30%	42.40%	0.84%	37.48%	NA
Indica II	465	28.40%	5.60%	1.94%	64.09%	NA
Indica III	913	20.50%	8.70%	1.53%	69.33%	NA
Indica Intermediate	786	24.40%	12.60%	2.04%	60.94%	NA
Temperate Japonica	767	96.70%	0.30%	0.00%	3.00%	NA
Tropical Japonica	504	44.00%	0.20%	1.59%	54.17%	NA
Japonica Intermediate	241	57.30%	0.40%	0.41%	41.91%	NA
VI/Aromatic	96	74.00%	0.00%	1.04%	25.00%	NA
Intermediate	90	66.70%	3.30%	0.00%	30.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1217659093	C -> DEL	LOC_Os12g29600.1	N	frameshift_variant	Average:31.595; most accessible tissue: Zhenshan97 flower, score: 71.071	N	N	N	N
vg1217659093	C -> G	LOC_Os12g29600.1	synonymous_variant ; p.Thr61Thr; LOW	synonymous_codon	Average:31.595; most accessible tissue: Zhenshan97 flower, score: 71.071	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1217659093	NA	4.87E-06	mr1194_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217659093	NA	3.65E-10	mr1215_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217659093	NA	3.47E-07	mr1215_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217659093	NA	2.99E-10	mr1220_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217659093	NA	9.17E-07	mr1220_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217659093	NA	1.11E-08	mr1221_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217659093	NA	5.43E-07	mr1227_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217659093	NA	6.45E-07	mr1302_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217659093	NA	2.47E-06	mr1306_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217659093	NA	9.33E-06	mr1422_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217659093	NA	1.51E-07	mr1583_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217659093	NA	1.42E-06	mr1844_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217659093	NA	2.36E-06	mr1849_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217659093	NA	2.17E-11	mr1850_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217659093	NA	5.10E-06	mr1869_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251