\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1217659093:

Variant ID: vg1217659093 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 17659093
Reference Allele: CAlternative Allele: G
Primary Allele: CSecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GAGCCGCTCACAATGCAATTATCTAGACCCGAGTCGACAACACCAACGTCTTCGTCACGCCTCAACAGAACGCGGTCACGGCAATTACCCTGTTCGACAC[C/G]
ATCATCGACAAGGCTCCAACCAATGTGACACCAATCATGAATAAAGTCAAGGCCATGATCGCCACCACTGTGCCCATGGATGCTGGAGGCAGCCGTTGGC

Reverse complement sequence

GCCAACGGCTGCCTCCAGCATCCATGGGCACAGTGGTGGCGATCATGGCCTTGACTTTATTCATGATTGGTGTCACATTGGTTGGAGCCTTGTCGATGAT[G/C]
GTGTCGAACAGGGTAATTGCCGTGACCGCGTTCTGTTGAGGCGTGACGAAGACGTTGGTGTTGTCGACTCGGGTCTAGATAATTGCATTGTGAGCGGCTC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 42.20% 9.80% 1.18% 46.85% NA
All Indica  2759 22.70% 16.50% 1.59% 59.19% NA
All Japonica  1512 72.90% 0.30% 0.60% 26.26% NA
Aus  269 49.80% 0.00% 0.74% 49.44% NA
Indica I  595 19.30% 42.40% 0.84% 37.48% NA
Indica II  465 28.40% 5.60% 1.94% 64.09% NA
Indica III  913 20.50% 8.70% 1.53% 69.33% NA
Indica Intermediate  786 24.40% 12.60% 2.04% 60.94% NA
Temperate Japonica  767 96.70% 0.30% 0.00% 3.00% NA
Tropical Japonica  504 44.00% 0.20% 1.59% 54.17% NA
Japonica Intermediate  241 57.30% 0.40% 0.41% 41.91% NA
VI/Aromatic  96 74.00% 0.00% 1.04% 25.00% NA
Intermediate  90 66.70% 3.30% 0.00% 30.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1217659093 C -> DEL LOC_Os12g29600.1 N frameshift_variant Average:31.595; most accessible tissue: Zhenshan97 flower, score: 71.071 N N N N
vg1217659093 C -> G LOC_Os12g29600.1 synonymous_variant ; p.Thr61Thr; LOW synonymous_codon Average:31.595; most accessible tissue: Zhenshan97 flower, score: 71.071 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1217659093 NA 4.87E-06 mr1194_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217659093 NA 3.65E-10 mr1215_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217659093 NA 3.47E-07 mr1215_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217659093 NA 2.99E-10 mr1220_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217659093 NA 9.17E-07 mr1220_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217659093 NA 1.11E-08 mr1221_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217659093 NA 5.43E-07 mr1227_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217659093 NA 6.45E-07 mr1302_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217659093 NA 2.47E-06 mr1306_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217659093 NA 9.33E-06 mr1422_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217659093 NA 1.51E-07 mr1583_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217659093 NA 1.42E-06 mr1844_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217659093 NA 2.36E-06 mr1849_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217659093 NA 2.17E-11 mr1850_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217659093 NA 5.10E-06 mr1869_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251