\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1217649778:

Variant ID: vg1217649778 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 17649778
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 286. )

Flanking Sequence (100 bp) in Reference Genome:


GAAGCATAAAGTCTAAACAATCAAGTTTTTTTTTTTTACTGATTTTCAGAGCGGTGGATACCTTAGCTAATTTAGATTGACAAAACGATTTAGTTGATAC[C/T]
GACAAAACCCTAGAAAAGGCCTAGCTGATACAGGTAATTTGAGCCATCAATTTAGATTAACTAAGATATATGATAATCAATAGTTGTATAAGATAGATTA

Reverse complement sequence

TAATCTATCTTATACAACTATTGATTATCATATATCTTAGTTAATCTAAATTGATGGCTCAAATTACCTGTATCAGCTAGGCCTTTTCTAGGGTTTTGTC[G/A]
GTATCAACTAAATCGTTTTGTCAATCTAAATTAGCTAAGGTATCCACCGCTCTGAAAATCAGTAAAAAAAAAAAACTTGATTGTTTAGACTTTATGCTTC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 83.00% 16.60% 0.42% 0.00% NA
All Indica  2759 83.20% 16.80% 0.04% 0.00% NA
All Japonica  1512 81.20% 17.60% 1.19% 0.00% NA
Aus  269 82.50% 17.50% 0.00% 0.00% NA
Indica I  595 58.00% 42.00% 0.00% 0.00% NA
Indica II  465 94.40% 5.40% 0.22% 0.00% NA
Indica III  913 91.60% 8.40% 0.00% 0.00% NA
Indica Intermediate  786 85.90% 14.10% 0.00% 0.00% NA
Temperate Japonica  767 97.40% 2.60% 0.00% 0.00% NA
Tropical Japonica  504 65.10% 34.30% 0.60% 0.00% NA
Japonica Intermediate  241 63.50% 30.30% 6.22% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 90.00% 8.90% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1217649778 C -> T LOC_Os12g29580-LOC_Os12g29590 intergenic_region ; MODIFIER silent_mutation Average:41.807; most accessible tissue: Callus, score: 67.004 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1217649778 NA 4.64E-06 mr1215 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217649778 NA 4.71E-06 mr1308 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217649778 2.50E-06 NA mr1583 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217649778 9.65E-06 2.68E-07 mr1308_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217649778 NA 2.53E-06 mr1361_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217649778 NA 3.64E-09 mr1583_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217649778 NA 3.52E-06 mr1662_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217649778 NA 4.00E-06 mr1849_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217649778 NA 2.97E-08 mr1850_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251