\
| Variant ID: vg1217649778 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 17649778 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 286. )
GAAGCATAAAGTCTAAACAATCAAGTTTTTTTTTTTTACTGATTTTCAGAGCGGTGGATACCTTAGCTAATTTAGATTGACAAAACGATTTAGTTGATAC[C/T]
GACAAAACCCTAGAAAAGGCCTAGCTGATACAGGTAATTTGAGCCATCAATTTAGATTAACTAAGATATATGATAATCAATAGTTGTATAAGATAGATTA
TAATCTATCTTATACAACTATTGATTATCATATATCTTAGTTAATCTAAATTGATGGCTCAAATTACCTGTATCAGCTAGGCCTTTTCTAGGGTTTTGTC[G/A]
GTATCAACTAAATCGTTTTGTCAATCTAAATTAGCTAAGGTATCCACCGCTCTGAAAATCAGTAAAAAAAAAAAACTTGATTGTTTAGACTTTATGCTTC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 83.00% | 16.60% | 0.42% | 0.00% | NA |
| All Indica | 2759 | 83.20% | 16.80% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 81.20% | 17.60% | 1.19% | 0.00% | NA |
| Aus | 269 | 82.50% | 17.50% | 0.00% | 0.00% | NA |
| Indica I | 595 | 58.00% | 42.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 94.40% | 5.40% | 0.22% | 0.00% | NA |
| Indica III | 913 | 91.60% | 8.40% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 85.90% | 14.10% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 97.40% | 2.60% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 65.10% | 34.30% | 0.60% | 0.00% | NA |
| Japonica Intermediate | 241 | 63.50% | 30.30% | 6.22% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 90.00% | 8.90% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1217649778 | C -> T | LOC_Os12g29580-LOC_Os12g29590 | intergenic_region ; MODIFIER | silent_mutation | Average:41.807; most accessible tissue: Callus, score: 67.004 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1217649778 | NA | 4.64E-06 | mr1215 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217649778 | NA | 4.71E-06 | mr1308 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217649778 | 2.50E-06 | NA | mr1583 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217649778 | 9.65E-06 | 2.68E-07 | mr1308_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217649778 | NA | 2.53E-06 | mr1361_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217649778 | NA | 3.64E-09 | mr1583_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217649778 | NA | 3.52E-06 | mr1662_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217649778 | NA | 4.00E-06 | mr1849_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217649778 | NA | 2.97E-08 | mr1850_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |