Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1217636564:

Variant ID: vg1217636564 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 17636564
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.01, others allele: 0.00, population size: 86. )

Flanking Sequence (100 bp) in Reference Genome:

ATACCTCTCTAGTTCATTCTGTGAGAGAGCTCCACCCAGCTCCACTCCCATTTTAAGTGGAGCTGAAACTGTTTGGCTGAGCTCCAGCTCCAGAAAAGGT[G/A]
AAACTGAAGATATAGTTATGCTAAACAGGCCCTACTATTAGAAGTCTAAAACAACAAAAGGTAAAAAAAAAAAAACAACAACATAAGAGTAGCTTCAATG

Reverse complement sequence

CATTGAAGCTACTCTTATGTTGTTGTTTTTTTTTTTTTACCTTTTGTTGTTTTAGACTTCTAATAGTAGGGCCTGTTTAGCATAACTATATCTTCAGTTT[C/T]
ACCTTTTCTGGAGCTGGAGCTCAGCCAAACAGTTTCAGCTCCACTTAAAATGGGAGTGGAGCTGGGTGGAGCTCTCTCACAGAATGAACTAGAGAGGTAT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	83.20%	16.70%	0.17%	0.00%	NA
All Indica	2759	75.60%	24.10%	0.29%	0.00%	NA
All Japonica	1512	99.40%	0.60%	0.00%	0.00%	NA
Aus	269	63.20%	36.80%	0.00%	0.00%	NA
Indica I	595	70.10%	29.90%	0.00%	0.00%	NA
Indica II	465	86.70%	13.10%	0.22%	0.00%	NA
Indica III	913	77.00%	22.50%	0.55%	0.00%	NA
Indica Intermediate	786	71.60%	28.10%	0.25%	0.00%	NA
Temperate Japonica	767	99.70%	0.30%	0.00%	0.00%	NA
Tropical Japonica	504	99.40%	0.60%	0.00%	0.00%	NA
Japonica Intermediate	241	98.30%	1.70%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	84.40%	15.60%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1217636564	G -> A	LOC_Os12g29580.1	upstream_gene_variant ; 4138.0bp to feature; MODIFIER	silent_mutation	Average:57.798; most accessible tissue: Zhenshan97 root, score: 78.911	N	N	N	N
vg1217636564	G -> A	LOC_Os12g29580.2	upstream_gene_variant ; 4172.0bp to feature; MODIFIER	silent_mutation	Average:57.798; most accessible tissue: Zhenshan97 root, score: 78.911	N	N	N	N
vg1217636564	G -> A	LOC_Os12g29580-LOC_Os12g29590	intergenic_region ; MODIFIER	silent_mutation	Average:57.798; most accessible tissue: Zhenshan97 root, score: 78.911	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1217636564	NA	1.26E-06	mr1020	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217636564	NA	3.55E-09	mr1032	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217636564	NA	9.08E-06	mr1063	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217636564	NA	2.16E-08	mr1165	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217636564	NA	9.70E-08	mr1180	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217636564	NA	1.93E-07	mr1183	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217636564	NA	5.83E-06	mr1477	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217636564	NA	7.64E-10	mr1478	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217636564	NA	1.69E-07	mr1503	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217636564	NA	8.15E-10	mr1627	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217636564	NA	1.21E-06	mr1653	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217636564	NA	1.14E-06	mr1950	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217636564	NA	4.66E-09	mr1971	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217636564	NA	6.20E-06	mr1128_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217636564	NA	3.79E-08	mr1165_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217636564	NA	2.64E-07	mr1180_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217636564	NA	8.81E-08	mr1183_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217636564	NA	3.54E-07	mr1653_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217636564	NA	3.96E-06	mr1671_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217636564	NA	4.32E-06	mr1854_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217636564	NA	8.13E-06	mr1856_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251