\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1217635826:

Variant ID: vg1217635826 (JBrowse)Variation Type: INDEL
Chromosome: chr12Position: 17635826
Reference Allele: CAlternative Allele: T,CTTAT
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.62, C: 0.38, others allele: 0.00, population size: 85. )

Flanking Sequence (100 bp) in Reference Genome:


AAACTAGTGTATGAGTAGATGGATGGGACATAAAGTATTAGTCCCTCCGTCTCAAAATAAGTGCAGTTATGGAAATCCGTGTCCAACGTTTGACCGTCCG[C/T,CTTAT]
CTTATTTGAAAAATTTATAATTTTTTTAAAAAATAGTCACACATAAAGTACTCTTCGTGTTTTATCATCTAACAACAATAAAAAATACTAATCATAAAAA

Reverse complement sequence

TTTTTATGATTAGTATTTTTTATTGTTGTTAGATGATAAAACACGAAGAGTACTTTATGTGTGACTATTTTTTAAAAAAATTATAAATTTTTCAAATAAG[G/A,ATAAG]
CGGACGGTCAAACGTTGGACACGGATTTCCATAACTGCACTTATTTTGAGACGGAGGGACTAATACTTTATGTCCCATCCATCTACTCATACACTAGTTT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 66.70% 32.70% 0.51% 0.00% CTTAT: 0.11%
All Indica  2759 64.90% 34.10% 0.83% 0.00% CTTAT: 0.18%
All Japonica  1512 78.60% 21.40% 0.00% 0.00% NA
Aus  269 30.10% 69.90% 0.00% 0.00% NA
Indica I  595 55.50% 44.40% 0.17% 0.00% NA
Indica II  465 66.50% 32.50% 1.08% 0.00% NA
Indica III  913 75.70% 23.30% 0.55% 0.00% CTTAT: 0.44%
Indica Intermediate  786 58.50% 39.80% 1.53% 0.00% CTTAT: 0.13%
Temperate Japonica  767 91.90% 8.10% 0.00% 0.00% NA
Tropical Japonica  504 61.10% 38.90% 0.00% 0.00% NA
Japonica Intermediate  241 73.00% 27.00% 0.00% 0.00% NA
VI/Aromatic  96 37.50% 62.50% 0.00% 0.00% NA
Intermediate  90 62.20% 36.70% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1217635826 C -> CTTAT LOC_Os12g29580.1 upstream_gene_variant ; 3401.0bp to feature; MODIFIER silent_mutation Average:51.459; most accessible tissue: Zhenshan97 panicle, score: 91.536 N N N N
vg1217635826 C -> CTTAT LOC_Os12g29580.2 upstream_gene_variant ; 3435.0bp to feature; MODIFIER silent_mutation Average:51.459; most accessible tissue: Zhenshan97 panicle, score: 91.536 N N N N
vg1217635826 C -> CTTAT LOC_Os12g29580-LOC_Os12g29590 intergenic_region ; MODIFIER silent_mutation Average:51.459; most accessible tissue: Zhenshan97 panicle, score: 91.536 N N N N
vg1217635826 C -> T LOC_Os12g29580.1 upstream_gene_variant ; 3400.0bp to feature; MODIFIER silent_mutation Average:51.459; most accessible tissue: Zhenshan97 panicle, score: 91.536 N N N N
vg1217635826 C -> T LOC_Os12g29580.2 upstream_gene_variant ; 3434.0bp to feature; MODIFIER silent_mutation Average:51.459; most accessible tissue: Zhenshan97 panicle, score: 91.536 N N N N
vg1217635826 C -> T LOC_Os12g29580-LOC_Os12g29590 intergenic_region ; MODIFIER silent_mutation Average:51.459; most accessible tissue: Zhenshan97 panicle, score: 91.536 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1217635826 NA 1.24E-17 Plant_height All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1217635826 NA 1.26E-07 mr1059 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217635826 NA 1.61E-07 mr1458 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217635826 NA 4.10E-06 mr1627 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217635826 NA 2.01E-06 mr1950 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217635826 NA 3.99E-06 mr1045_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217635826 NA 6.15E-07 mr1053_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217635826 NA 9.24E-06 mr1060_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217635826 NA 5.57E-06 mr1084_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217635826 NA 3.83E-06 mr1115_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217635826 NA 2.99E-07 mr1128_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217635826 NA 5.15E-06 mr1147_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217635826 NA 4.22E-06 mr1194_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217635826 NA 4.67E-07 mr1204_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217635826 NA 7.87E-06 mr1205_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217635826 NA 6.50E-06 mr1206_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217635826 NA 4.85E-06 mr1207_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217635826 NA 2.93E-06 mr1215_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217635826 NA 9.01E-09 mr1220_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217635826 NA 2.71E-06 mr1252_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217635826 NA 5.43E-06 mr1299_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217635826 NA 4.90E-06 mr1306_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217635826 NA 3.34E-06 mr1359_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217635826 NA 1.16E-06 mr1376_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217635826 NA 7.43E-06 mr1421_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217635826 NA 1.39E-06 mr1431_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217635826 1.94E-06 1.94E-06 mr1487_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217635826 NA 3.15E-06 mr1528_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217635826 NA 6.03E-06 mr1566_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217635826 NA 5.89E-06 mr1605_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217635826 NA 4.95E-06 mr1759_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217635826 NA 2.81E-07 mr1844_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217635826 NA 2.39E-07 mr1854_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217635826 NA 4.06E-06 mr1876_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251