Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1217634589:

Variant ID: vg1217634589 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 17634589
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.94, G: 0.05, others allele: 0.00, population size: 99. )

Flanking Sequence (100 bp) in Reference Genome:


AAGTTGAAGATCGAATTTGCTCATCTGAATAAAGGGTAGTATATATACTACATGCATCGAATACAAGTAAATGTTTTTAATTTTGTCCCAGACTATAAAA[A/G]
AGAATTGTTTTTTAGCTGTTGAACATTTTGATGCTTACTAAGTAAGTATATATATATACATATACATATATATATATATATATATGTATATATATGTATA

Reverse complement sequence

TATACATATATATACATATATATATATATATATATGTATATGTATATATATATACTTACTTAGTAAGCATCAAAATGTTCAACAGCTAAAAAACAATTCT[T/C]
TTTTATAGTCTGGGACAAAATTAAAAACATTTACTTGTATTCGATGCATGTAGTATATATACTACCCTTTATTCAGATGAGCAAATTCGATCTTCAACTT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 83.50% 16.20% 0.30% 0.00% NA
All Indica  2759 83.30% 16.50% 0.25% 0.00% NA
All Japonica  1512 88.70% 11.30% 0.00% 0.00% NA
Aus  269 56.10% 41.60% 2.23% 0.00% NA
Indica I  595 70.30% 29.70% 0.00% 0.00% NA
Indica II  465 90.10% 9.90% 0.00% 0.00% NA
Indica III  913 91.20% 8.20% 0.55% 0.00% NA
Indica Intermediate  786 79.80% 20.00% 0.25% 0.00% NA
Temperate Japonica  767 95.80% 4.20% 0.00% 0.00% NA
Tropical Japonica  504 79.60% 20.40% 0.00% 0.00% NA
Japonica Intermediate  241 85.10% 14.90% 0.00% 0.00% NA
VI/Aromatic  96 89.60% 10.40% 0.00% 0.00% NA
Intermediate  90 81.10% 17.80% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1217634589 A -> G LOC_Os12g29580.1 upstream_gene_variant ; 2163.0bp to feature; MODIFIER silent_mutation Average:46.982; most accessible tissue: Zhenshan97 root, score: 89.659 N N N N
vg1217634589 A -> G LOC_Os12g29580.2 upstream_gene_variant ; 2197.0bp to feature; MODIFIER silent_mutation Average:46.982; most accessible tissue: Zhenshan97 root, score: 89.659 N N N N
vg1217634589 A -> G LOC_Os12g29580-LOC_Os12g29590 intergenic_region ; MODIFIER silent_mutation Average:46.982; most accessible tissue: Zhenshan97 root, score: 89.659 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1217634589 A G -0.08 -0.02 0.0 -0.01 -0.02 -0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1217634589 NA 7.62E-07 mr1032 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217634589 NA 2.53E-06 mr1165 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217634589 NA 2.71E-06 mr1180 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217634589 NA 2.63E-07 mr1478 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217634589 NA 1.18E-06 mr1503 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217634589 NA 6.28E-09 mr1627 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217634589 NA 2.53E-06 mr1692 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217634589 NA 1.71E-06 mr1839 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217634589 NA 2.23E-07 mr1950 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217634589 NA 1.51E-06 mr1971 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217634589 NA 7.10E-06 mr1053_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217634589 NA 2.70E-07 mr1128_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217634589 NA 9.19E-07 mr1165_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217634589 NA 3.07E-07 mr1183_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217634589 NA 5.22E-06 mr1528_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217634589 NA 7.95E-06 mr1579_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217634589 NA 3.06E-07 mr1653_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217634589 NA 1.11E-06 mr1813_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217634589 NA 3.74E-06 mr1823_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217634589 NA 2.51E-06 mr1831_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217634589 3.26E-06 6.61E-09 mr1854_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217634589 NA 3.10E-06 mr1856_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217634589 NA 7.77E-07 mr1876_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217634589 NA 5.98E-06 mr1894_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251