\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1217631816:

Variant ID: vg1217631816 (JBrowse)Variation Type: INDEL
Chromosome: chr12Position: 17631816
Reference Allele: CAAlternative Allele: AA,CAAA,CAA,C,CAAAA,CAAAAAAA
Primary Allele: CASecondary Allele: AA

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TATTTTTCTTCCCTCCCATTATTTCTCGAAGAAGAAGCAGATTAAACTGCAAGACTCAAAAATCTCCTCCCATTACTTGATGATGAAGCAGATGAAACCG[CA/AA,CAAA,CAA,C,CAAAA,CAAAAAAA]
AAAAAAAAAAAACTTTGAACCCCGAAACGCGAAGCGCACACGGCACCGAAATCTCCAAAAAAAAAAAAAAACGCCCGCTAAAAACGGAGAGGTCAAACGA

Reverse complement sequence

TCGTTTGACCTCTCCGTTTTTAGCGGGCGTTTTTTTTTTTTTTTGGAGATTTCGGTGCCGTGTGCGCTTCGCGTTTCGGGGTTCAAAGTTTTTTTTTTTT[TG/TT,TTTG,TTG,G,TTTTG,TTTTTTTG]
CGGTTTCATCTGCTTCATCATCAAGTAATGGGAGGAGATTTTTGAGTCTTGCAGTTTAATCTGCTTCTTCTTCGAGAAATAATGGGAGGGAAGAAAAATA

Allele Frequencies:

Populations Population SizeFrequency of CA(primary allele) Frequency of AA(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 27.20% 13.40% 38.09% 13.35% CAA: 5.25%; C: 1.44%; CAAA: 0.99%; CAAAA: 0.21%; CAAAAAAA: 0.06%
All Indica  2759 9.20% 11.60% 48.06% 21.09% CAA: 7.54%; C: 1.45%; CAAA: 0.65%; CAAAA: 0.33%; CAAAAAAA: 0.07%
All Japonica  1512 54.20% 19.30% 22.42% 0.40% CAA: 1.92%; CAAA: 1.59%; C: 0.07%; CAAAAAAA: 0.07%
Aus  269 56.90% 0.70% 17.84% 13.38% C: 9.29%; CAA: 0.74%; CAAA: 0.74%; CAAAA: 0.37%
Indica I  595 6.10% 6.40% 64.03% 3.87% CAA: 16.97%; C: 2.52%; CAAA: 0.17%
Indica II  465 11.60% 3.00% 52.26% 29.68% CAA: 1.51%; CAAA: 1.29%; CAAAAAAA: 0.43%; C: 0.22%
Indica III  913 8.00% 19.50% 35.82% 28.92% CAA: 6.13%; C: 0.88%; CAAAA: 0.55%; CAAA: 0.22%
Indica Intermediate  786 11.50% 11.60% 47.71% 19.97% CAA: 5.60%; C: 2.04%; CAAA: 1.15%; CAAAA: 0.51%
Temperate Japonica  767 89.70% 2.10% 6.52% 0.26% CAA: 0.91%; CAAA: 0.39%; C: 0.13%
Tropical Japonica  504 12.30% 35.50% 44.64% 0.40% CAAA: 3.97%; CAA: 2.98%; CAAAAAAA: 0.20%
Japonica Intermediate  241 29.00% 40.20% 26.56% 0.83% CAA: 2.90%; CAAA: 0.41%
VI/Aromatic  96 28.10% 1.00% 58.33% 1.04% CAA: 7.29%; C: 2.08%; CAAA: 2.08%
Intermediate  90 35.60% 20.00% 34.44% 6.67% CAA: 2.22%; CAAA: 1.11%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1217631816 CA -> C LOC_Os12g29580.1 intron_variant ; MODIFIER silent_mutation Average:80.618; most accessible tissue: Zhenshan97 flower, score: 92.539 N N N N
vg1217631816 CA -> C LOC_Os12g29580.2 intron_variant ; MODIFIER silent_mutation Average:80.618; most accessible tissue: Zhenshan97 flower, score: 92.539 N N N N
vg1217631816 CA -> CAA LOC_Os12g29580.1 intron_variant ; MODIFIER silent_mutation Average:80.618; most accessible tissue: Zhenshan97 flower, score: 92.539 N N N N
vg1217631816 CA -> CAA LOC_Os12g29580.2 intron_variant ; MODIFIER silent_mutation Average:80.618; most accessible tissue: Zhenshan97 flower, score: 92.539 N N N N
vg1217631816 CA -> CAAAAAAA LOC_Os12g29580.1 intron_variant ; MODIFIER silent_mutation Average:80.618; most accessible tissue: Zhenshan97 flower, score: 92.539 N N N N
vg1217631816 CA -> CAAAAAAA LOC_Os12g29580.2 intron_variant ; MODIFIER silent_mutation Average:80.618; most accessible tissue: Zhenshan97 flower, score: 92.539 N N N N
vg1217631816 CA -> CAAA LOC_Os12g29580.1 intron_variant ; MODIFIER silent_mutation Average:80.618; most accessible tissue: Zhenshan97 flower, score: 92.539 N N N N
vg1217631816 CA -> CAAA LOC_Os12g29580.2 intron_variant ; MODIFIER silent_mutation Average:80.618; most accessible tissue: Zhenshan97 flower, score: 92.539 N N N N
vg1217631816 CA -> CAAAA LOC_Os12g29580.1 intron_variant ; MODIFIER silent_mutation Average:80.618; most accessible tissue: Zhenshan97 flower, score: 92.539 N N N N
vg1217631816 CA -> CAAAA LOC_Os12g29580.2 intron_variant ; MODIFIER silent_mutation Average:80.618; most accessible tissue: Zhenshan97 flower, score: 92.539 N N N N
vg1217631816 CA -> DEL N N silent_mutation Average:80.618; most accessible tissue: Zhenshan97 flower, score: 92.539 N N N N
vg1217631816 CA -> AA LOC_Os12g29580.1 intron_variant ; MODIFIER silent_mutation Average:80.618; most accessible tissue: Zhenshan97 flower, score: 92.539 N N N N
vg1217631816 CA -> AA LOC_Os12g29580.2 intron_variant ; MODIFIER silent_mutation Average:80.618; most accessible tissue: Zhenshan97 flower, score: 92.539 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1217631816 CA AA 0.0 -0.01 -0.01 -0.01 0.0 0.0
vg1217631816 CA C 0.03 0.05 0.05 -0.01 0.03 0.07
vg1217631816 CA CAA 0.03 0.07 0.07 0.01 0.04 0.06
vg1217631816 CA CAAA 0.04 0.05 0.08 -0.02 0.04 0.1
vg1217631816 CA CAAAA -0.03 0.06 0.08 0.02 0.03 0.03
vg1217631816 CA CAAAA* 0.12 0.19 0.2 0.07 0.09 0.08

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1217631816 NA 5.02E-06 mr1114 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217631816 NA 8.13E-07 mr1120 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217631816 3.28E-06 NA mr1275 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217631816 NA 1.52E-06 mr1583 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217631816 NA 7.72E-07 mr1662_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251