\
| Variant ID: vg1217609308 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 17609308 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.82, A: 0.17, others allele: 0.00, population size: 107. )
GGAGTGATAGACTTGAAGGAAATTTTTTAAGAGGTTAGAGCTCTTGCTAAATTTCTTTCAAAATCTCTATATGCTTGTCCATTCCATAGGAATTCAAAAG[G/A]
ATAACATAGGATTCAATCCTTTATTTCAAAGGCTTTTATAGAAAATTTTCCTATATGATTGAAATCCTCCAAAATTCGTATATTTTTCTTCCAAATCAAA
TTTGATTTGGAAGAAAAATATACGAATTTTGGAGGATTTCAATCATATAGGAAAATTTTCTATAAAAGCCTTTGAAATAAAGGATTGAATCCTATGTTAT[C/T]
CTTTTGAATTCCTATGGAATGGACAAGCATATAGAGATTTTGAAAGAAATTTAGCAAGAGCTCTAACCTCTTAAAAAATTTCCTTCAAGTCTATCACTCC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 80.00% | 17.30% | 0.11% | 2.58% | NA |
| All Indica | 2759 | 77.70% | 18.50% | 0.11% | 3.62% | NA |
| All Japonica | 1512 | 88.70% | 11.20% | 0.07% | 0.07% | NA |
| Aus | 269 | 50.20% | 41.60% | 0.37% | 7.81% | NA |
| Indica I | 595 | 69.70% | 30.30% | 0.00% | 0.00% | NA |
| Indica II | 465 | 73.30% | 9.50% | 0.22% | 16.99% | NA |
| Indica III | 913 | 86.90% | 12.60% | 0.00% | 0.55% | NA |
| Indica Intermediate | 786 | 75.80% | 21.90% | 0.25% | 2.04% | NA |
| Temperate Japonica | 767 | 95.60% | 4.40% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 80.00% | 19.80% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 85.10% | 14.50% | 0.00% | 0.41% | NA |
| VI/Aromatic | 96 | 91.70% | 8.30% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 81.10% | 18.90% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1217609308 | G -> DEL | N | N | silent_mutation | Average:28.425; most accessible tissue: Callus, score: 50.539 | N | N | N | N |
| vg1217609308 | G -> A | LOC_Os12g29550.1 | upstream_gene_variant ; 3068.0bp to feature; MODIFIER | silent_mutation | Average:28.425; most accessible tissue: Callus, score: 50.539 | N | N | N | N |
| vg1217609308 | G -> A | LOC_Os12g29540.1 | intron_variant ; MODIFIER | silent_mutation | Average:28.425; most accessible tissue: Callus, score: 50.539 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1217609308 | NA | 1.35E-06 | mr1032 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217609308 | NA | 1.77E-07 | mr1059 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217609308 | NA | 3.70E-06 | mr1165 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217609308 | NA | 4.77E-07 | mr1478 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217609308 | NA | 9.21E-09 | mr1627 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217609308 | NA | 4.38E-06 | mr1692 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217609308 | NA | 2.08E-06 | mr1839 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217609308 | NA | 2.59E-07 | mr1950 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217609308 | NA | 1.86E-06 | mr1971 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217609308 | NA | 7.55E-06 | mr1053_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217609308 | NA | 2.01E-07 | mr1128_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217609308 | NA | 7.10E-07 | mr1165_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217609308 | NA | 4.07E-06 | mr1566_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217609308 | NA | 1.14E-06 | mr1653_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217609308 | NA | 3.61E-06 | mr1813_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217609308 | NA | 7.24E-06 | mr1823_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217609308 | NA | 2.61E-06 | mr1831_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217609308 | NA | 4.79E-08 | mr1854_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217609308 | NA | 8.11E-06 | mr1856_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217609308 | NA | 8.05E-07 | mr1876_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |