\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1217609308:

Variant ID: vg1217609308 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 17609308
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.82, A: 0.17, others allele: 0.00, population size: 107. )

Flanking Sequence (100 bp) in Reference Genome:


GGAGTGATAGACTTGAAGGAAATTTTTTAAGAGGTTAGAGCTCTTGCTAAATTTCTTTCAAAATCTCTATATGCTTGTCCATTCCATAGGAATTCAAAAG[G/A]
ATAACATAGGATTCAATCCTTTATTTCAAAGGCTTTTATAGAAAATTTTCCTATATGATTGAAATCCTCCAAAATTCGTATATTTTTCTTCCAAATCAAA

Reverse complement sequence

TTTGATTTGGAAGAAAAATATACGAATTTTGGAGGATTTCAATCATATAGGAAAATTTTCTATAAAAGCCTTTGAAATAAAGGATTGAATCCTATGTTAT[C/T]
CTTTTGAATTCCTATGGAATGGACAAGCATATAGAGATTTTGAAAGAAATTTAGCAAGAGCTCTAACCTCTTAAAAAATTTCCTTCAAGTCTATCACTCC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 80.00% 17.30% 0.11% 2.58% NA
All Indica  2759 77.70% 18.50% 0.11% 3.62% NA
All Japonica  1512 88.70% 11.20% 0.07% 0.07% NA
Aus  269 50.20% 41.60% 0.37% 7.81% NA
Indica I  595 69.70% 30.30% 0.00% 0.00% NA
Indica II  465 73.30% 9.50% 0.22% 16.99% NA
Indica III  913 86.90% 12.60% 0.00% 0.55% NA
Indica Intermediate  786 75.80% 21.90% 0.25% 2.04% NA
Temperate Japonica  767 95.60% 4.40% 0.00% 0.00% NA
Tropical Japonica  504 80.00% 19.80% 0.20% 0.00% NA
Japonica Intermediate  241 85.10% 14.50% 0.00% 0.41% NA
VI/Aromatic  96 91.70% 8.30% 0.00% 0.00% NA
Intermediate  90 81.10% 18.90% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1217609308 G -> DEL N N silent_mutation Average:28.425; most accessible tissue: Callus, score: 50.539 N N N N
vg1217609308 G -> A LOC_Os12g29550.1 upstream_gene_variant ; 3068.0bp to feature; MODIFIER silent_mutation Average:28.425; most accessible tissue: Callus, score: 50.539 N N N N
vg1217609308 G -> A LOC_Os12g29540.1 intron_variant ; MODIFIER silent_mutation Average:28.425; most accessible tissue: Callus, score: 50.539 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1217609308 NA 1.35E-06 mr1032 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217609308 NA 1.77E-07 mr1059 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217609308 NA 3.70E-06 mr1165 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217609308 NA 4.77E-07 mr1478 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217609308 NA 9.21E-09 mr1627 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217609308 NA 4.38E-06 mr1692 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217609308 NA 2.08E-06 mr1839 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217609308 NA 2.59E-07 mr1950 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217609308 NA 1.86E-06 mr1971 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217609308 NA 7.55E-06 mr1053_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217609308 NA 2.01E-07 mr1128_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217609308 NA 7.10E-07 mr1165_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217609308 NA 4.07E-06 mr1566_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217609308 NA 1.14E-06 mr1653_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217609308 NA 3.61E-06 mr1813_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217609308 NA 7.24E-06 mr1823_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217609308 NA 2.61E-06 mr1831_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217609308 NA 4.79E-08 mr1854_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217609308 NA 8.11E-06 mr1856_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217609308 NA 8.05E-07 mr1876_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251