\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1217575687:

Variant ID: vg1217575687 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 17575687
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.01, others allele: 0.00, population size: 345. )

Flanking Sequence (100 bp) in Reference Genome:


ATTATGCATCTAAGATCAAAGTAAATGGGTCCACAAGACACAAAAATGGTCTGTATTGCATTATACTAACAAGTAAAGGCTGGGAATTCATGTCATGGAG[G/A]
CTGAGGAAACAAACATGAAAGAGCTGGATACATTCTTTTGGCACAAATCCATTACAAGGAGGATGAAGTATCACCTCGGAAGATGTGACGGAAGCGCCAC

Reverse complement sequence

GTGGCGCTTCCGTCACATCTTCCGAGGTGATACTTCATCCTCCTTGTAATGGATTTGTGCCAAAAGAATGTATCCAGCTCTTTCATGTTTGTTTCCTCAG[C/T]
CTCCATGACATGAATTCCCAGCCTTTACTTGTTAGTATAATGCAATACAGACCATTTTTGTGTCTTGTGGACCCATTTACTTTGATCTTAGATGCATAAT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 89.50% 10.50% 0.06% 0.00% NA
All Indica  2759 82.40% 17.50% 0.11% 0.00% NA
All Japonica  1512 99.50% 0.50% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 74.30% 25.70% 0.00% 0.00% NA
Indica II  465 90.80% 9.20% 0.00% 0.00% NA
Indica III  913 88.60% 11.40% 0.00% 0.00% NA
Indica Intermediate  786 76.50% 23.20% 0.38% 0.00% NA
Temperate Japonica  767 99.90% 0.10% 0.00% 0.00% NA
Tropical Japonica  504 99.40% 0.60% 0.00% 0.00% NA
Japonica Intermediate  241 98.30% 1.70% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 95.60% 4.40% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1217575687 G -> A LOC_Os12g29520.1 intron_variant ; MODIFIER silent_mutation Average:66.366; most accessible tissue: Minghui63 flag leaf, score: 85.67 N N N N
vg1217575687 G -> A LOC_Os12g29520.2 intron_variant ; MODIFIER silent_mutation Average:66.366; most accessible tissue: Minghui63 flag leaf, score: 85.67 N N N N
vg1217575687 G -> A LOC_Os12g29520.3 intron_variant ; MODIFIER silent_mutation Average:66.366; most accessible tissue: Minghui63 flag leaf, score: 85.67 N N N N
vg1217575687 G -> A LOC_Os12g29520.4 intron_variant ; MODIFIER silent_mutation Average:66.366; most accessible tissue: Minghui63 flag leaf, score: 85.67 N N N N
vg1217575687 G -> A LOC_Os12g29520.5 intron_variant ; MODIFIER silent_mutation Average:66.366; most accessible tissue: Minghui63 flag leaf, score: 85.67 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1217575687 NA 1.41E-15 Plant_height Ind_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1217575687 NA 9.71E-07 mr1032 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217575687 NA 9.09E-06 mr1165 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217575687 NA 3.10E-07 mr1180 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217575687 NA 6.10E-07 mr1183 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217575687 NA 2.14E-06 mr1246 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217575687 NA 6.39E-07 mr1478 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217575687 NA 4.68E-07 mr1503 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217575687 3.18E-06 3.39E-06 mr1525 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217575687 NA 2.33E-10 mr1627 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217575687 NA 7.93E-07 mr1653 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217575687 NA 6.82E-08 mr1660 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217575687 NA 7.72E-06 mr1660 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217575687 NA 2.72E-07 mr1971 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217575687 NA 2.48E-06 mr1165_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217575687 NA 1.75E-06 mr1180_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217575687 NA 5.96E-06 mr1215_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217575687 NA 3.91E-06 mr1220_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217575687 NA 1.76E-07 mr1653_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251