Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1217575687:

Variant ID: vg1217575687 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 17575687
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.01, others allele: 0.00, population size: 345. )

Flanking Sequence (100 bp) in Reference Genome:

ATTATGCATCTAAGATCAAAGTAAATGGGTCCACAAGACACAAAAATGGTCTGTATTGCATTATACTAACAAGTAAAGGCTGGGAATTCATGTCATGGAG[G/A]
CTGAGGAAACAAACATGAAAGAGCTGGATACATTCTTTTGGCACAAATCCATTACAAGGAGGATGAAGTATCACCTCGGAAGATGTGACGGAAGCGCCAC

Reverse complement sequence

GTGGCGCTTCCGTCACATCTTCCGAGGTGATACTTCATCCTCCTTGTAATGGATTTGTGCCAAAAGAATGTATCCAGCTCTTTCATGTTTGTTTCCTCAG[C/T]
CTCCATGACATGAATTCCCAGCCTTTACTTGTTAGTATAATGCAATACAGACCATTTTTGTGTCTTGTGGACCCATTTACTTTGATCTTAGATGCATAAT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	89.50%	10.50%	0.06%	0.00%	NA
All Indica	2759	82.40%	17.50%	0.11%	0.00%	NA
All Japonica	1512	99.50%	0.50%	0.00%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	74.30%	25.70%	0.00%	0.00%	NA
Indica II	465	90.80%	9.20%	0.00%	0.00%	NA
Indica III	913	88.60%	11.40%	0.00%	0.00%	NA
Indica Intermediate	786	76.50%	23.20%	0.38%	0.00%	NA
Temperate Japonica	767	99.90%	0.10%	0.00%	0.00%	NA
Tropical Japonica	504	99.40%	0.60%	0.00%	0.00%	NA
Japonica Intermediate	241	98.30%	1.70%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	95.60%	4.40%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1217575687	G -> A	LOC_Os12g29520.1	intron_variant ; MODIFIER	silent_mutation	Average:66.366; most accessible tissue: Minghui63 flag leaf, score: 85.67	N	N	N	N
vg1217575687	G -> A	LOC_Os12g29520.2	intron_variant ; MODIFIER	silent_mutation	Average:66.366; most accessible tissue: Minghui63 flag leaf, score: 85.67	N	N	N	N
vg1217575687	G -> A	LOC_Os12g29520.3	intron_variant ; MODIFIER	silent_mutation	Average:66.366; most accessible tissue: Minghui63 flag leaf, score: 85.67	N	N	N	N
vg1217575687	G -> A	LOC_Os12g29520.4	intron_variant ; MODIFIER	silent_mutation	Average:66.366; most accessible tissue: Minghui63 flag leaf, score: 85.67	N	N	N	N
vg1217575687	G -> A	LOC_Os12g29520.5	intron_variant ; MODIFIER	silent_mutation	Average:66.366; most accessible tissue: Minghui63 flag leaf, score: 85.67	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1217575687	NA	1.41E-15	Plant_height	Ind_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1217575687	NA	9.71E-07	mr1032	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217575687	NA	9.09E-06	mr1165	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217575687	NA	3.10E-07	mr1180	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217575687	NA	6.10E-07	mr1183	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217575687	NA	2.14E-06	mr1246	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217575687	NA	6.39E-07	mr1478	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217575687	NA	4.68E-07	mr1503	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217575687	3.18E-06	3.39E-06	mr1525	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217575687	NA	2.33E-10	mr1627	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217575687	NA	7.93E-07	mr1653	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217575687	NA	6.82E-08	mr1660	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217575687	NA	7.72E-06	mr1660	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217575687	NA	2.72E-07	mr1971	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217575687	NA	2.48E-06	mr1165_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217575687	NA	1.75E-06	mr1180_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217575687	NA	5.96E-06	mr1215_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217575687	NA	3.91E-06	mr1220_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217575687	NA	1.76E-07	mr1653_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251