\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1217569480:

Variant ID: vg1217569480 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 17569480
Reference Allele: GAlternative Allele: T
Primary Allele: TSecondary Allele: G

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.63, G: 0.38, others allele: 0.00, population size: 90. )

Flanking Sequence (100 bp) in Reference Genome:


AGTAAGCAACTATTGTATGAATTGACTATTACATTGGCTATAGATGATTTGTAGCTAGTAGTGGGCTATACTATTAAACTTGCTCTAAGTGCAACACAAG[G/T]
GACAAAGGTTTCCACTAAATCCAGAGAACCTCGTACGCCATCGGCGTTCGTCTATCTACATAGGAGCTGGTTAATTAGTCGCCGGCCGACCGACACGGCC

Reverse complement sequence

GGCCGTGTCGGTCGGCCGGCGACTAATTAACCAGCTCCTATGTAGATAGACGAACGCCGATGGCGTACGAGGTTCTCTGGATTTAGTGGAAACCTTTGTC[C/A]
CTTGTGTTGCACTTAGAGCAAGTTTAATAGTATAGCCCACTACTAGCTACAAATCATCTATAGCCAATGTAATAGTCAATTCATACAATAGTTGCTTACT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 54.90% 44.90% 0.19% 0.02% NA
All Indica  2759 60.10% 39.80% 0.14% 0.04% NA
All Japonica  1512 40.10% 59.60% 0.26% 0.00% NA
Aus  269 90.00% 10.00% 0.00% 0.00% NA
Indica I  595 83.50% 16.30% 0.17% 0.00% NA
Indica II  465 49.90% 49.70% 0.22% 0.22% NA
Indica III  913 48.40% 51.60% 0.00% 0.00% NA
Indica Intermediate  786 61.80% 37.90% 0.25% 0.00% NA
Temperate Japonica  767 7.30% 92.70% 0.00% 0.00% NA
Tropical Japonica  504 80.00% 19.20% 0.79% 0.00% NA
Japonica Intermediate  241 61.40% 38.60% 0.00% 0.00% NA
VI/Aromatic  96 45.80% 54.20% 0.00% 0.00% NA
Intermediate  90 51.10% 47.80% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1217569480 G -> DEL N N silent_mutation Average:74.827; most accessible tissue: Minghui63 panicle, score: 94.307 N N N N
vg1217569480 G -> T LOC_Os12g29520.1 downstream_gene_variant ; 2057.0bp to feature; MODIFIER silent_mutation Average:74.827; most accessible tissue: Minghui63 panicle, score: 94.307 N N N N
vg1217569480 G -> T LOC_Os12g29520.2 downstream_gene_variant ; 2057.0bp to feature; MODIFIER silent_mutation Average:74.827; most accessible tissue: Minghui63 panicle, score: 94.307 N N N N
vg1217569480 G -> T LOC_Os12g29520.3 downstream_gene_variant ; 2057.0bp to feature; MODIFIER silent_mutation Average:74.827; most accessible tissue: Minghui63 panicle, score: 94.307 N N N N
vg1217569480 G -> T LOC_Os12g29520.4 downstream_gene_variant ; 2057.0bp to feature; MODIFIER silent_mutation Average:74.827; most accessible tissue: Minghui63 panicle, score: 94.307 N N N N
vg1217569480 G -> T LOC_Os12g29520.5 downstream_gene_variant ; 2057.0bp to feature; MODIFIER silent_mutation Average:74.827; most accessible tissue: Minghui63 panicle, score: 94.307 N N N N
vg1217569480 G -> T LOC_Os12g29510-LOC_Os12g29520 intergenic_region ; MODIFIER silent_mutation Average:74.827; most accessible tissue: Minghui63 panicle, score: 94.307 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1217569480 G T 0.0 -0.02 -0.02 -0.08 -0.05 -0.04

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1217569480 NA 3.30E-06 mr1082 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217569480 NA 3.78E-07 mr1388 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217569480 NA 2.16E-06 mr1543 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217569480 NA 2.42E-07 mr1829 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217569480 NA 8.04E-09 mr1866 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217569480 NA 9.98E-06 mr1091_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217569480 NA 6.89E-06 mr1159_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217569480 3.81E-06 3.80E-06 mr1412_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217569480 NA 5.64E-08 mr1502_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217569480 NA 1.74E-10 mr1543_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217569480 NA 1.67E-08 mr1645_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217569480 NA 3.79E-06 mr1647_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217569480 NA 7.49E-07 mr1680_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217569480 NA 3.60E-08 mr1700_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217569480 NA 1.05E-07 mr1747_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217569480 NA 2.35E-06 mr1759_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217569480 NA 1.39E-07 mr1808_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217569480 NA 1.51E-06 mr1814_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217569480 NA 3.20E-06 mr1823_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217569480 NA 1.32E-08 mr1829_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217569480 NA 2.11E-07 mr1831_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217569480 NA 1.21E-07 mr1840_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217569480 NA 6.45E-09 mr1856_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217569480 NA 1.37E-08 mr1871_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217569480 NA 2.48E-06 mr1892_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217569480 NA 9.71E-09 mr1952_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251