\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1217569463:

Variant ID: vg1217569463 (JBrowse)Variation Type: INDEL
Chromosome: chr12Position: 17569463
Reference Allele: TAlternative Allele: C,TAA
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.97, C: 0.03, others allele: 0.00, population size: 109. )

Flanking Sequence (100 bp) in Reference Genome:


ACTAAGTATAATAGTATAGTAAGCAACTATTGTATGAATTGACTATTACATTGGCTATAGATGATTTGTAGCTAGTAGTGGGCTATACTATTAAACTTGC[T/C,TAA]
CTAAGTGCAACACAAGGGACAAAGGTTTCCACTAAATCCAGAGAACCTCGTACGCCATCGGCGTTCGTCTATCTACATAGGAGCTGGTTAATTAGTCGCC

Reverse complement sequence

GGCGACTAATTAACCAGCTCCTATGTAGATAGACGAACGCCGATGGCGTACGAGGTTCTCTGGATTTAGTGGAAACCTTTGTCCCTTGTGTTGCACTTAG[A/G,TTA]
GCAAGTTTAATAGTATAGCCCACTACTAGCTACAAATCATCTATAGCCAATGTAATAGTCAATTCATACAATAGTTGCTTACTATACTATTATACTTAGT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 59.20% 30.40% 10.30% 0.00% TAA: 0.04%
All Indica  2759 56.70% 30.70% 12.54% 0.00% TAA: 0.07%
All Japonica  1512 60.80% 32.00% 7.14% 0.00% NA
Aus  269 73.60% 26.00% 0.37% 0.00% NA
Indica I  595 26.40% 47.10% 26.39% 0.00% TAA: 0.17%
Indica II  465 73.80% 15.70% 10.54% 0.00% NA
Indica III  913 69.00% 24.10% 6.90% 0.00% NA
Indica Intermediate  786 55.30% 34.70% 9.80% 0.00% TAA: 0.13%
Temperate Japonica  767 93.00% 6.90% 0.13% 0.00% NA
Tropical Japonica  504 21.60% 58.70% 19.64% 0.00% NA
Japonica Intermediate  241 40.70% 56.00% 3.32% 0.00% NA
VI/Aromatic  96 63.50% 11.50% 25.00% 0.00% NA
Intermediate  90 61.10% 30.00% 8.89% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1217569463 T -> C LOC_Os12g29520.1 downstream_gene_variant ; 2074.0bp to feature; MODIFIER silent_mutation Average:74.269; most accessible tissue: Minghui63 panicle, score: 94.307 N N N N
vg1217569463 T -> C LOC_Os12g29520.2 downstream_gene_variant ; 2074.0bp to feature; MODIFIER silent_mutation Average:74.269; most accessible tissue: Minghui63 panicle, score: 94.307 N N N N
vg1217569463 T -> C LOC_Os12g29520.3 downstream_gene_variant ; 2074.0bp to feature; MODIFIER silent_mutation Average:74.269; most accessible tissue: Minghui63 panicle, score: 94.307 N N N N
vg1217569463 T -> C LOC_Os12g29520.4 downstream_gene_variant ; 2074.0bp to feature; MODIFIER silent_mutation Average:74.269; most accessible tissue: Minghui63 panicle, score: 94.307 N N N N
vg1217569463 T -> C LOC_Os12g29520.5 downstream_gene_variant ; 2074.0bp to feature; MODIFIER silent_mutation Average:74.269; most accessible tissue: Minghui63 panicle, score: 94.307 N N N N
vg1217569463 T -> C LOC_Os12g29510-LOC_Os12g29520 intergenic_region ; MODIFIER silent_mutation Average:74.269; most accessible tissue: Minghui63 panicle, score: 94.307 N N N N
vg1217569463 T -> TAA LOC_Os12g29520.1 downstream_gene_variant ; 2073.0bp to feature; MODIFIER silent_mutation Average:74.269; most accessible tissue: Minghui63 panicle, score: 94.307 N N N N
vg1217569463 T -> TAA LOC_Os12g29520.2 downstream_gene_variant ; 2073.0bp to feature; MODIFIER silent_mutation Average:74.269; most accessible tissue: Minghui63 panicle, score: 94.307 N N N N
vg1217569463 T -> TAA LOC_Os12g29520.3 downstream_gene_variant ; 2073.0bp to feature; MODIFIER silent_mutation Average:74.269; most accessible tissue: Minghui63 panicle, score: 94.307 N N N N
vg1217569463 T -> TAA LOC_Os12g29520.4 downstream_gene_variant ; 2073.0bp to feature; MODIFIER silent_mutation Average:74.269; most accessible tissue: Minghui63 panicle, score: 94.307 N N N N
vg1217569463 T -> TAA LOC_Os12g29520.5 downstream_gene_variant ; 2073.0bp to feature; MODIFIER silent_mutation Average:74.269; most accessible tissue: Minghui63 panicle, score: 94.307 N N N N
vg1217569463 T -> TAA LOC_Os12g29510-LOC_Os12g29520 intergenic_region ; MODIFIER silent_mutation Average:74.269; most accessible tissue: Minghui63 panicle, score: 94.307 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1217569463 T C 0.02 0.03 0.02 0.01 0.02 0.03
vg1217569463 T TAA -0.06 0.01 0.02 -0.06 -0.01 0.04

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1217569463 1.55E-07 5.23E-09 mr1388 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217569463 2.44E-06 2.43E-06 mr1601 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217569463 NA 7.23E-06 mr1602 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217569463 NA 2.00E-06 mr1835 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217569463 NA 1.83E-06 mr1977 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217569463 NA 3.11E-07 mr1042_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217569463 NA 4.09E-06 mr1043_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217569463 NA 2.67E-07 mr1350_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217569463 NA 2.32E-06 mr1479_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217569463 NA 1.15E-08 mr1502_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217569463 NA 1.76E-09 mr1543_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217569463 NA 3.60E-07 mr1582_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217569463 NA 1.44E-07 mr1680_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217569463 NA 6.32E-06 mr1747_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217569463 NA 9.62E-06 mr1759_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217569463 NA 4.23E-08 mr1871_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217569463 NA 2.81E-06 mr1892_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251