\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1217556649:

Variant ID: vg1217556649 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 17556649
Reference Allele: GAlternative Allele: C,A
Primary Allele: GSecondary Allele: C

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.87, C: 0.14, others allele: 0.00, population size: 286. )

Flanking Sequence (100 bp) in Reference Genome:


CCTGTTCATCTCTCTTTCAGGAACATCTTGTTCTACATACTTACATTGCTCAATTTTGAGCGATTCGATCTAATATGCGGTTTTCGCTTTCGGAGAAGGC[G/C,A]
TCCATTTTCGATGATCATACCTTCTTCTCCTCTTGCAGCTGCTGGGTGCCTTGACTTGCTAGGAAATAGTTTGCAGCTCCTTTTCCATGGATGCTGACCT

Reverse complement sequence

AGGTCAGCATCCATGGAAAAGGAGCTGCAAACTATTTCCTAGCAAGTCAAGGCACCCAGCAGCTGCAAGAGGAGAAGAAGGTATGATCATCGAAAATGGA[C/G,T]
GCCTTCTCCGAAAGCGAAAACCGCATATTAGATCGAATCGCTCAAAATTGAGCAATGTAAGTATGTAGAACAAGATGTTCCTGAAAGAGAGATGAACAGG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 53.40% 46.50% 0.06% 0.00% NA
All Indica  2759 23.70% 76.30% 0.04% 0.00% NA
All Japonica  1512 98.70% 1.20% 0.07% 0.00% NA
Aus  269 81.40% 18.60% 0.00% 0.00% NA
Indica I  595 16.60% 83.20% 0.17% 0.00% NA
Indica II  465 34.00% 66.00% 0.00% 0.00% NA
Indica III  913 21.60% 78.40% 0.00% 0.00% NA
Indica Intermediate  786 25.30% 74.70% 0.00% 0.00% NA
Temperate Japonica  767 99.00% 1.00% 0.00% 0.00% NA
Tropical Japonica  504 98.60% 1.40% 0.00% 0.00% NA
Japonica Intermediate  241 98.30% 1.20% 0.41% 0.00% NA
VI/Aromatic  96 96.90% 3.10% 0.00% 0.00% NA
Intermediate  90 74.40% 24.40% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1217556649 G -> C LOC_Os12g29510-LOC_Os12g29520 intergenic_region ; MODIFIER silent_mutation Average:70.186; most accessible tissue: Zhenshan97 flower, score: 90.77 N N N N
vg1217556649 G -> A LOC_Os12g29510-LOC_Os12g29520 intergenic_region ; MODIFIER N Average:70.186; most accessible tissue: Zhenshan97 flower, score: 90.77 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1217556649 G A -0.04 -0.03 -0.02 -0.03 -0.05 -0.04
vg1217556649 G C -0.05 -0.03 -0.02 -0.02 -0.08 -0.11

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1217556649 NA 7.06E-06 mr1129 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217556649 NA 2.94E-07 mr1220 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217556649 NA 6.65E-06 mr1257 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217556649 NA 7.05E-06 mr1435 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217556649 6.02E-06 3.08E-13 mr1023_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217556649 NA 1.23E-13 mr1055_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217556649 1.78E-06 NA mr1079_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217556649 5.26E-07 2.34E-14 mr1079_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217556649 4.93E-06 NA mr1132_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217556649 1.15E-07 2.23E-15 mr1132_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217556649 NA 5.26E-13 mr1178_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217556649 NA 1.10E-08 mr1198_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217556649 5.09E-06 NA mr1390_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217556649 1.22E-06 1.95E-14 mr1390_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217556649 3.60E-07 1.13E-11 mr1489_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217556649 4.07E-06 NA mr1490_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217556649 4.03E-06 1.86E-12 mr1490_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251