Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1217552425:

Variant ID: vg1217552425 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 17552425
Reference Allele: G	Alternative Allele: T
Primary Allele: G	Secondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.73, G: 0.29, others allele: 0.00, population size: 59. )

Flanking Sequence (100 bp) in Reference Genome:

TATTACCATGTGCCCCATACATATATATTAAGCGGTTAATATTTTAATTACATGTGTTAAGTCCTTTAAAATTTATTAAAATGCTCTCAAACTGCCACGT[G/T]
GTGCTCTAATAAATTAGAGCAAATATTAGAAATTCTAAGAAAAAAAAGCAAAGTATCCACTGCTTAATTTTCACTTAAATCGGGACATCCAATATTATAA

Reverse complement sequence

TTATAATATTGGATGTCCCGATTTAAGTGAAAATTAAGCAGTGGATACTTTGCTTTTTTTTCTTAGAATTTCTAATATTTGCTCTAATTTATTAGAGCAC[C/A]
ACGTGGCAGTTTGAGAGCATTTTAATAAATTTTAAAGGACTTAACACATGTAATTAAAATATTAACCGCTTAATATATATGTATGGGGCACATGGTAATA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	45.60%	16.60%	14.35%	23.38%	NA
All Indica	2759	42.40%	24.90%	17.36%	15.37%	NA
All Japonica	1512	56.90%	1.80%	0.60%	40.67%	NA
Aus	269	24.90%	19.00%	50.93%	5.20%	NA
Indica I	595	80.80%	13.30%	3.19%	2.69%	NA
Indica II	465	25.20%	32.90%	28.17%	13.76%	NA
Indica III	913	26.10%	26.20%	18.84%	28.92%	NA
Indica Intermediate	786	42.40%	27.50%	19.97%	10.18%	NA
Temperate Japonica	767	78.40%	1.00%	0.13%	20.47%	NA
Tropical Japonica	504	27.40%	1.00%	0.60%	71.03%	NA
Japonica Intermediate	241	50.60%	5.80%	2.07%	41.49%	NA
VI/Aromatic	96	12.50%	9.40%	39.58%	38.54%	NA
Intermediate	90	53.30%	13.30%	16.67%	16.67%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1217552425	G -> DEL	N	N	silent_mutation	Average:14.578; most accessible tissue: Zhenshan97 root, score: 22.162	N	N	N	N
vg1217552425	G -> T	LOC_Os12g29510-LOC_Os12g29520	intergenic_region ; MODIFIER	silent_mutation	Average:14.578; most accessible tissue: Zhenshan97 root, score: 22.162	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1217552425	NA	2.39E-06	mr1031	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217552425	NA	3.40E-06	mr1056	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217552425	NA	6.51E-06	mr1104	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217552425	NA	4.64E-08	mr1155	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217552425	NA	9.05E-06	mr1227	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217552425	NA	3.86E-07	mr1272	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217552425	NA	1.10E-09	mr1291	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217552425	NA	5.33E-07	mr1291	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217552425	NA	1.56E-06	mr1324	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217552425	6.96E-06	7.01E-08	mr1335	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217552425	NA	1.36E-06	mr1502	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217552425	3.94E-06	3.94E-06	mr1513	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217552425	NA	2.90E-07	mr1577	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217552425	2.65E-06	7.34E-07	mr1590	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217552425	NA	1.34E-07	mr1660	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217552425	NA	4.28E-06	mr1676	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217552425	NA	8.97E-07	mr1709	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217552425	2.51E-06	1.01E-07	mr1755	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217552425	NA	6.66E-10	mr1761	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217552425	NA	9.11E-06	mr1761	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217552425	NA	1.10E-07	mr1815	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217552425	NA	3.55E-06	mr1815	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217552425	NA	5.56E-06	mr1892	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217552425	NA	8.10E-07	mr1958	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217552425	NA	2.11E-06	mr1958	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217552425	3.67E-06	3.67E-06	mr1964	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217552425	NA	3.63E-06	mr1975	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217552425	NA	1.86E-07	mr1155_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217552425	NA	4.51E-16	mr1557_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251