\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1217552425:

Variant ID: vg1217552425 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 17552425
Reference Allele: GAlternative Allele: T
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.73, G: 0.29, others allele: 0.00, population size: 59. )

Flanking Sequence (100 bp) in Reference Genome:


TATTACCATGTGCCCCATACATATATATTAAGCGGTTAATATTTTAATTACATGTGTTAAGTCCTTTAAAATTTATTAAAATGCTCTCAAACTGCCACGT[G/T]
GTGCTCTAATAAATTAGAGCAAATATTAGAAATTCTAAGAAAAAAAAGCAAAGTATCCACTGCTTAATTTTCACTTAAATCGGGACATCCAATATTATAA

Reverse complement sequence

TTATAATATTGGATGTCCCGATTTAAGTGAAAATTAAGCAGTGGATACTTTGCTTTTTTTTCTTAGAATTTCTAATATTTGCTCTAATTTATTAGAGCAC[C/A]
ACGTGGCAGTTTGAGAGCATTTTAATAAATTTTAAAGGACTTAACACATGTAATTAAAATATTAACCGCTTAATATATATGTATGGGGCACATGGTAATA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 45.60% 16.60% 14.35% 23.38% NA
All Indica  2759 42.40% 24.90% 17.36% 15.37% NA
All Japonica  1512 56.90% 1.80% 0.60% 40.67% NA
Aus  269 24.90% 19.00% 50.93% 5.20% NA
Indica I  595 80.80% 13.30% 3.19% 2.69% NA
Indica II  465 25.20% 32.90% 28.17% 13.76% NA
Indica III  913 26.10% 26.20% 18.84% 28.92% NA
Indica Intermediate  786 42.40% 27.50% 19.97% 10.18% NA
Temperate Japonica  767 78.40% 1.00% 0.13% 20.47% NA
Tropical Japonica  504 27.40% 1.00% 0.60% 71.03% NA
Japonica Intermediate  241 50.60% 5.80% 2.07% 41.49% NA
VI/Aromatic  96 12.50% 9.40% 39.58% 38.54% NA
Intermediate  90 53.30% 13.30% 16.67% 16.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1217552425 G -> DEL N N silent_mutation Average:14.578; most accessible tissue: Zhenshan97 root, score: 22.162 N N N N
vg1217552425 G -> T LOC_Os12g29510-LOC_Os12g29520 intergenic_region ; MODIFIER silent_mutation Average:14.578; most accessible tissue: Zhenshan97 root, score: 22.162 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1217552425 NA 2.39E-06 mr1031 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217552425 NA 3.40E-06 mr1056 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217552425 NA 6.51E-06 mr1104 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217552425 NA 4.64E-08 mr1155 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217552425 NA 9.05E-06 mr1227 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217552425 NA 3.86E-07 mr1272 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217552425 NA 1.10E-09 mr1291 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217552425 NA 5.33E-07 mr1291 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217552425 NA 1.56E-06 mr1324 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217552425 6.96E-06 7.01E-08 mr1335 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217552425 NA 1.36E-06 mr1502 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217552425 3.94E-06 3.94E-06 mr1513 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217552425 NA 2.90E-07 mr1577 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217552425 2.65E-06 7.34E-07 mr1590 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217552425 NA 1.34E-07 mr1660 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217552425 NA 4.28E-06 mr1676 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217552425 NA 8.97E-07 mr1709 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217552425 2.51E-06 1.01E-07 mr1755 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217552425 NA 6.66E-10 mr1761 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217552425 NA 9.11E-06 mr1761 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217552425 NA 1.10E-07 mr1815 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217552425 NA 3.55E-06 mr1815 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217552425 NA 5.56E-06 mr1892 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217552425 NA 8.10E-07 mr1958 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217552425 NA 2.11E-06 mr1958 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217552425 3.67E-06 3.67E-06 mr1964 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217552425 NA 3.63E-06 mr1975 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217552425 NA 1.86E-07 mr1155_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217552425 NA 4.51E-16 mr1557_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251