\
| Variant ID: vg1217551737 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 17551737 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, A: 0.03, others allele: 0.00, population size: 80. )
GAATTAAACACTGTGGGTTGTGTTTTTTCCAACATTTAGCTCTGTTTAAGCTGAAACCGAGAGTTGATTACAGAATAATTATAATGTATCGTGTTATGTC[A/G]
TATTTGGATTTTGTACTATTTATTCATATAGGTGAAAGAAATTATTATATTATAAATCTGAGCACAATATTAACGAATATCAAGAGAACTCTTACAAAGA
TCTTTGTAAGAGTTCTCTTGATATTCGTTAATATTGTGCTCAGATTTATAATATAATAATTTCTTTCACCTATATGAATAAATAGTACAAAATCCAAATA[T/C]
GACATAACACGATACATTATAATTATTCTGTAATCAACTCTCGGTTTCAGCTTAAACAGAGCTAAATGTTGGAAAAAACACAACCCACAGTGTTTAATTC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 64.20% | 20.00% | 0.83% | 14.92% | NA |
| All Indica | 2759 | 89.40% | 8.80% | 0.58% | 1.20% | NA |
| All Japonica | 1512 | 14.90% | 44.00% | 0.66% | 40.48% | NA |
| Aus | 269 | 91.40% | 4.10% | 0.37% | 4.09% | NA |
| Indica I | 595 | 88.40% | 8.70% | 1.18% | 1.68% | NA |
| Indica II | 465 | 90.80% | 9.00% | 0.00% | 0.22% | NA |
| Indica III | 913 | 88.60% | 10.30% | 0.55% | 0.55% | NA |
| Indica Intermediate | 786 | 90.20% | 7.10% | 0.51% | 2.16% | NA |
| Temperate Japonica | 767 | 1.70% | 77.30% | 0.65% | 20.34% | NA |
| Tropical Japonica | 504 | 27.80% | 1.40% | 0.40% | 70.44% | NA |
| Japonica Intermediate | 241 | 29.90% | 27.00% | 1.24% | 41.91% | NA |
| VI/Aromatic | 96 | 50.00% | 1.00% | 9.38% | 39.58% | NA |
| Intermediate | 90 | 56.70% | 27.80% | 3.33% | 12.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1217551737 | A -> DEL | N | N | silent_mutation | Average:17.764; most accessible tissue: Minghui63 young leaf, score: 21.268 | N | N | N | N |
| vg1217551737 | A -> G | LOC_Os12g29510-LOC_Os12g29520 | intergenic_region ; MODIFIER | silent_mutation | Average:17.764; most accessible tissue: Minghui63 young leaf, score: 21.268 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1217551737 | NA | 1.15E-10 | mr1198 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217551737 | NA | 7.29E-13 | mr1239 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217551737 | NA | 9.51E-09 | mr1275 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217551737 | NA | 1.63E-06 | mr1420 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217551737 | NA | 2.61E-06 | mr1443 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217551737 | 6.59E-06 | NA | mr1458 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217551737 | 7.72E-07 | 2.02E-09 | mr1458 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217551737 | 8.90E-06 | NA | mr1536 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217551737 | 1.86E-06 | 1.86E-06 | mr1564 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217551737 | NA | 4.07E-06 | mr1578 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217551737 | NA | 1.19E-12 | mr1641 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217551737 | NA | 9.99E-10 | mr1659 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217551737 | 2.12E-06 | 4.48E-09 | mr1819 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217551737 | NA | 1.22E-09 | mr1866 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217551737 | NA | 1.04E-06 | mr1457_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217551737 | 8.14E-07 | NA | mr1458_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217551737 | 5.79E-10 | 5.25E-16 | mr1458_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217551737 | NA | 7.68E-06 | mr1577_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |