\
| Variant ID: vg1217551232 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 17551232 |
| Reference Allele: C | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
TACACATCTATATTGCGTACCTATCAAATAAACAATTTAAGATCTATATTAACTGATTTATACGTACACTTAAACTGATGGACCCACTATTTAAATCATT[C/G]
GAACTATTTTTATTACATTGGACTATTATTCTCAAATAATGCATTCTTTCAAAATAAAGTCTACAACATTATATACTATATACTGTGTACCCATTAAATT
AATTTAATGGGTACACAGTATATAGTATATAATGTTGTAGACTTTATTTTGAAAGAATGCATTATTTGAGAATAATAGTCCAATGTAATAAAAATAGTTC[G/C]
AATGATTTAAATAGTGGGTCCATCAGTTTAAGTGTACGTATAAATCAGTTAATATAGATCTTAAATTGTTTATTTGATAGGTACGCAATATAGATGTGTA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 70.20% | 14.60% | 0.57% | 14.62% | NA |
| All Indica | 2759 | 98.00% | 0.70% | 0.07% | 1.20% | NA |
| All Japonica | 1512 | 16.10% | 43.10% | 1.06% | 39.75% | NA |
| Aus | 269 | 95.50% | 0.00% | 1.86% | 2.60% | NA |
| Indica I | 595 | 98.00% | 0.30% | 0.00% | 1.68% | NA |
| Indica II | 465 | 97.40% | 2.40% | 0.00% | 0.22% | NA |
| Indica III | 913 | 99.00% | 0.30% | 0.11% | 0.55% | NA |
| Indica Intermediate | 786 | 97.30% | 0.40% | 0.13% | 2.16% | NA |
| Temperate Japonica | 767 | 2.90% | 76.40% | 0.26% | 20.47% | NA |
| Tropical Japonica | 504 | 28.40% | 0.80% | 2.78% | 68.06% | NA |
| Japonica Intermediate | 241 | 32.40% | 25.70% | 0.00% | 41.91% | NA |
| VI/Aromatic | 96 | 57.30% | 0.00% | 3.12% | 39.58% | NA |
| Intermediate | 90 | 63.30% | 22.20% | 1.11% | 13.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1217551232 | C -> DEL | N | N | silent_mutation | Average:18.806; most accessible tissue: Minghui63 panicle, score: 29.741 | N | N | N | N |
| vg1217551232 | C -> G | LOC_Os12g29510-LOC_Os12g29520 | intergenic_region ; MODIFIER | silent_mutation | Average:18.806; most accessible tissue: Minghui63 panicle, score: 29.741 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1217551232 | NA | 1.11E-16 | mr1116 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217551232 | NA | 1.19E-11 | mr1198 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217551232 | NA | 2.86E-26 | mr1223 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217551232 | NA | 9.26E-14 | mr1239 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217551232 | NA | 3.31E-09 | mr1275 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217551232 | NA | 1.76E-11 | mr1307 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217551232 | NA | 1.52E-34 | mr1350 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217551232 | NA | 6.12E-14 | mr1376 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217551232 | NA | 6.12E-14 | mr1431 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217551232 | NA | 9.09E-19 | mr1529 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217551232 | 5.40E-06 | 4.47E-41 | mr1601 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217551232 | NA | 1.34E-12 | mr1636 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217551232 | NA | 5.58E-17 | mr1653 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217551232 | NA | 1.20E-08 | mr1659 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217551232 | NA | 1.37E-06 | mr1681 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217551232 | NA | 3.62E-06 | mr1819 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217551232 | NA | 2.75E-09 | mr1866 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217551232 | NA | 3.96E-06 | mr1881 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217551232 | NA | 2.58E-33 | mr1944 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217551232 | NA | 1.05E-32 | mr1780_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |