\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1217493720:

Variant ID: vg1217493720 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 17493720
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, others allele: 0.00, population size: 254. )

Flanking Sequence (100 bp) in Reference Genome:


CGGTTAAAACAGCAGGAGAGGCTCCTACTGCGCAAATATATTAAAAAGAGAACGGCAAAATACAAGGGAAACTGTACAGAGGGAATACAACAGGGGGGAA[G/A]
AAAGAAAGAAGAAAAGACCGCCTGAAACGCAAGCTAGTTAATAAATGCTATTAATCCATGATTGCCACAATGGTTTTTCTGTCTCCTTTACTCTATGCAA

Reverse complement sequence

TTGCATAGAGTAAAGGAGACAGAAAAACCATTGTGGCAATCATGGATTAATAGCATTTATTAACTAGCTTGCGTTTCAGGCGGTCTTTTCTTCTTTCTTT[C/T]
TTCCCCCCTGTTGTATTCCCTCTGTACAGTTTCCCTTGTATTTTGCCGTTCTCTTTTTAATATATTTGCGCAGTAGGAGCCTCTCCTGCTGTTTTAACCG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 88.60% 5.10% 1.10% 5.23% NA
All Indica  2759 95.50% 2.00% 1.41% 1.09% NA
All Japonica  1512 83.20% 9.90% 0.20% 6.68% NA
Aus  269 53.90% 0.40% 3.72% 42.01% NA
Indica I  595 93.40% 0.00% 6.05% 0.50% NA
Indica II  465 90.50% 9.50% 0.00% 0.00% NA
Indica III  913 99.00% 0.40% 0.11% 0.44% NA
Indica Intermediate  786 95.80% 1.00% 0.25% 2.93% NA
Temperate Japonica  767 87.90% 0.10% 0.13% 11.86% NA
Tropical Japonica  504 72.40% 27.40% 0.20% 0.00% NA
Japonica Intermediate  241 90.90% 4.60% 0.41% 4.15% NA
VI/Aromatic  96 74.00% 25.00% 0.00% 1.04% NA
Intermediate  90 85.60% 12.20% 0.00% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1217493720 G -> DEL N N silent_mutation Average:41.051; most accessible tissue: Zhenshan97 young leaf, score: 61.964 N N N N
vg1217493720 G -> A LOC_Os12g29440.1 upstream_gene_variant ; 2898.0bp to feature; MODIFIER silent_mutation Average:41.051; most accessible tissue: Zhenshan97 young leaf, score: 61.964 N N N N
vg1217493720 G -> A LOC_Os12g29450.1 downstream_gene_variant ; 3303.0bp to feature; MODIFIER silent_mutation Average:41.051; most accessible tissue: Zhenshan97 young leaf, score: 61.964 N N N N
vg1217493720 G -> A LOC_Os12g29440-LOC_Os12g29450 intergenic_region ; MODIFIER silent_mutation Average:41.051; most accessible tissue: Zhenshan97 young leaf, score: 61.964 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1217493720 3.18E-07 NA mr1082 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217493720 NA 8.06E-07 mr1082 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217493720 2.77E-09 NA mr1083 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217493720 NA 2.30E-09 mr1083 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217493720 3.52E-06 NA mr1085 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217493720 1.72E-06 NA mr1103 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217493720 2.79E-06 NA mr1104 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217493720 2.52E-06 NA mr1204 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217493720 4.66E-08 NA mr1226 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217493720 NA 3.51E-08 mr1226 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217493720 NA 3.21E-06 mr1364 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217493720 NA 5.32E-07 mr1408 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217493720 1.27E-06 NA mr1411 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217493720 3.36E-06 NA mr1437 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217493720 NA 1.32E-06 mr1443 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217493720 NA 4.76E-08 mr1471 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217493720 3.34E-06 NA mr1560 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217493720 NA 3.53E-06 mr1642 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217493720 7.50E-07 7.49E-07 mr1076_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217493720 NA 4.68E-06 mr1082_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217493720 4.54E-09 NA mr1083_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217493720 NA 1.78E-08 mr1083_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217493720 1.77E-06 NA mr1103_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217493720 8.94E-09 NA mr1104_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217493720 NA 7.94E-07 mr1104_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217493720 7.42E-09 NA mr1107_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217493720 NA 1.17E-06 mr1107_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217493720 1.87E-10 NA mr1226_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217493720 NA 3.15E-09 mr1226_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217493720 5.03E-06 1.88E-09 mr1364_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217493720 NA 6.08E-10 mr1364_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217493720 NA 5.97E-09 mr1408_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217493720 NA 4.30E-06 mr1408_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251